Home About us Contact
|
Home About us Contact | ||
|
|
||
Vapour Diffusion (vapour + diffusion)
Kinds of Vapour Diffusion Selected AbstractsWhen less is more: a more efficient vapour-diffusion protocolACTA CRYSTALLOGRAPHICA SECTION D, Issue 10 2003Kirsty V. Dunlop Reducing protein consumption during crystallization screening is of utmost importance to crystallographers because of the time, effort and money that goes into producing pure protein. One approach is to reduce sample volumes with robotics, but a patent and the high cost of equipment limits access. Here, it is shown that the same result can be obtained by reducing the sample concentration in a modified vapour-diffusion protocol, the dilution method. In this protocol, the protein and mother liquor in the crystallization drop are both diluted, while the mother liquor in the well remains undiluted. Vapour diffusion will shrink the initial volume of the crystallization drop, e.g. 1,µl or more, to a drop size equivalent to one dispensed by a robot. This new crystallization method circumvents some of the current problems associated with robotic crystallization screening trials. Because of the large initial volume of the crystallization drop, the evaporation problem is eliminated and dispensing accuracy is improved. In addition, the likelihood that the crystallization experiment starts in the undersaturated region is increased. [source] Inter-particle contact heat transfer model: an extension to soils at elevated temperaturesINTERNATIONAL JOURNAL OF ENERGY RESEARCH, Issue 2 2005W. H. Leong Abstract A simple ,inter-particle contact heat transfer' model for predicting effective thermal conductivity of soils at moderate temperatures (0,30°C) has been extended up to 90°C. The extended model accounts for latent heat transport by water vapour diffusion in soil air above the permanent wilting point; below that point, the soil thermal conductivity is approximated by linear interpolation without latent heat effect. By and large the best results are obtained when the latent heat is used only in the ,self consistent approximation' model with an overall root mean square error of 35% for all soils under consideration or 26% when excluding volcanic soils. This option can also be applied to moderate temperatures at which the enhanced heat transfer is negligibly small. Copyright © 2005 John Wiley & Sons, Ltd. [source] An analysis of water vapour diffusion in whey protein filmsINTERNATIONAL JOURNAL OF FOOD SCIENCE & TECHNOLOGY, Issue 5 2003Cristiana M. P. Yoshida Summary The macroscopic aspects of moisture transmission in whey protein films were determined by measuring water vapour adsorption. A theoretical model was constructed in which two kinds of water vapour fluxes were considered: one originating from diffusion, whilst the other was a flux due to the gravitation drift of moisture. The comparison of theoretical and experimental results showed that only the diffusion process was present. [source] Early stages of protein crystallization as revealed by emerging optical waveguide technologyJOURNAL OF APPLIED CRYSTALLOGRAPHY, Issue 3 2008Attia Boudjemline A highly sensitive method for studying the onset of protein crystallization in real time using an optical-waveguide-based technique is reported. Dual polarization interferometry uses light from sensing and reference waveguides to produce an interference pattern, which when the sensing waveguide is immersed in a protein solution supplies information on the thickness and density of any protein adlayer on the sensing waveguide's surface. This technique provides evidence that crystallization proceeds via large protein aggregates but, more strikingly, shows dramatic light loss from the sensing waveguide at a very early stage during crystallization. The technique proves relatively insensitive to the crystallization of small molecules or poorly formed protein crystals and affords a method of distinguishing crystal formation from the formation of other protein aggregates or salt crystals. The experimental setup currently necessitates crystallization using the batch method, and precipitant mixing at high supersaturation is known to introduce a greater variability compared with methods such as vapour diffusion or dialysis, but first results promise to bridge the paucity of real-time methods available to distinguish the onset of protein crystallization from other forms of aggregation. [source] Étude de l'influence de l'évaporation d'un bac d'eau sur les transferts dans un canal corruguéTHE CANADIAN JOURNAL OF CHEMICAL ENGINEERING, Issue 2 2000Seghir Maamir Abstract Les auteurs présentent une étude numérique et expérimentale des transferts qui s'effectuent par convection forcée dans un canal comportant une protubérance sinusoîdale et par convection naturelle dans un bac d'eau. L'étude numérique a été effectuée pour des nombres de Reynolds compris entre 35 et 350, plusieurs densité de flux de chaleur et pour des amplitudes de la protubérance comprises entre 0.005 et 0.02 m. Les résultats montrent que la diffusion de la vapeur d'eau dans l'air modifie le profil des lignes de courant qui devient convexe au-dessus de la surface libre de l'eau. En outre, l'evaporation atténue la perturbation engendrée par la protubérance et augmente les transferts de chaleur dans le canal. La visualisation de l'ecoulement, réalisée à l'aide d'un générateur de fumée d'encens, d'un laser à argon et d'une caméra vidéo à mis en évidence la complexité de l'interaction entre le flux de vapeur engendré par l'évaporation de l'eau du bac, l'écoulement de l'air dans le canal et les déperditions de chaleur à travers les parois latérales. Les résultats théoriques et expéri-mentaux sont en bon accord qualitatif. The authors present a numerical and experimental study on heat and mass transfers by forced convection in a channel with a sinusoidal protuberance and by natural convection in a reservoir full of water. The numerical study has been carried out for Reynolds numbers in a range of 35 to 350, several densities of heat flux and protuberance amplitude range of 0.005 to 0.02 m. Results show that the vapour diffusion in the air modifies the stream function profiles which become convex over the free surface of the water. In addition, the evaporation reduces the perturbation caused by the protuberance and increases the heat transfer rate in the channel. The visualisation of the flow, using smoke, an argon laser and a videocamera, shows the complexity of the interaction between the flow of vapour caused by the evaporation, the flow in the channel and the heat losses across the lateral walls. Theoretical and experimental results are in good qualitative agreement. [source] The sodium salt of a tris(tridentate anion)gadolinium(III) complex: pentasodium bis[chelidamato(3,)][chelidamato(2,)]gadolinate(III) hexadecahydrateACTA CRYSTALLOGRAPHICA SECTION C, Issue 4 2000Annegret K. Hall The sodium salt of a complex anion formed between gadolinium(III) and three variously deprotonated chelidamic acid (4-hydroxypyridine-2,6-dicarboxylic acid) ligand moieties, assigned as Na5[Gd(C7H2NO5)2(C7H3NO5)]·16H2O, i.e. pentasodium (4-hydroxypyridine-2,6-dicarboxylate)bis(4-oxidopyridine-2,6-dicarboxylate)gadolinium(III) hexadecahydrate, forms as colourless monoclinic crystals upon vapour diffusion of ethanol into its aqueous solution. The ligand moieties, assigned as two trianionic and one dianionic chelidamate species, are all tridentate in the complex anion of tricapped trigonal prismatic donor-atom geometry. The geometry of the ligands and that of the primary coordination sphere is very similar to that of the analogous anionic tris(ligand),rare earth complexes of the pyridine-2,6-dicarboxylate (dipicolinate) dianion. [source] Structure of the mexicain,E-64 complex and comparison with other cysteine proteases of the papain familyACTA CRYSTALLOGRAPHICA SECTION D, Issue 5 2007J. A. Gavira Mexicain is a 23.8,kDa cysteine protease from the tropical plant Jacaratia mexicana. It is isolated as the most abundant product after cation-exchange chromatography of the mix of proteases extracted from the latex of the fruit. The purified enzyme inhibited with E-64 [N -(3-carboxyoxirane-2-carbonyl)-leucyl-amino(4-guanido)butane] was crystallized by sitting-drop vapour diffusion and the structure was solved by molecular replacement at 2.1,Å resolution and refined to an R factor of 17.7% (Rfree = 23.8%). The enzyme belongs to the ,+, class of proteins and the structure shows the typical papain-like fold composed of two domains, the ,-helix-rich (L) domain and the ,-barrel-like (R) domain, separated by a groove containing the active site formed by residues Cys25 and His159, one from each domain. The four monomers in the asymmetric unit show one E-64 molecule covalently bound to Cys25 in the active site and differences have been found in the placement of E-64 in each monomer. [source] Development of an automated large-scale protein-crystallization and monitoring system for high-throughput protein-structure analysesACTA CRYSTALLOGRAPHICA SECTION D, Issue 9 2006Masahiko Hiraki Protein crystallization remains one of the bottlenecks in crystallographic analysis of macromolecules. An automated large-scale protein-crystallization system named PXS has been developed consisting of the following subsystems, which proceed in parallel under unified control software: dispensing precipitants and protein solutions, sealing crystallization plates, carrying robot, incubators, observation system and image-storage server. A sitting-drop crystallization plate specialized for PXS has also been designed and developed. PXS can set up 7680 drops for vapour diffusion per hour, which includes time for replenishing supplies such as disposable tips and crystallization plates. Images of the crystallization drops are automatically recorded according to a preprogrammed schedule and can be viewed by users remotely using web-based browser software. A number of protein crystals were successfully produced and several protein structures could be determined directly from crystals grown by PXS. In other cases, X-ray quality crystals were obtained by further optimization by manual screening based on the conditions found by PXS. [source] Crystallization and preliminary crystallographic studies of MOMP (major outer membrane protein) from Campylobacter jejuniACTA CRYSTALLOGRAPHICA SECTION D, Issue 12-2 2004Jean Michel Bolla Campylobacter jejuni is the leading bacterial cause of human enteritis linked to ingestion of contaminated food or water. MOMP, the major outer membrane protein from these Gram-negative bacteria, belongs to the porin family. In order to determine the three-dimensional structure of this protein and to elucidate the underlying molecular mechanisms, the MOMP from C. jejuni strain 85H has been purified and crystallized by vapour diffusion. Two crystal forms were characterized for this membrane protein. X-ray diffraction data were collected to a resolution of 3.1,Å using a synchrotron-radiation source from the orthorhombic crystal form, which belonged to space group P21212 with unit-cell parameters a = 170.1, b = 101.9, c = 104.9,Å. With a trimer in the asymmetric unit, the solvent content is 64% (VM = 3.4,Å,Da,1). The other form exhibits trigonal symmetry (space group R3) with hexagonal unit-cell parameters a = b = 94.2, c = 161.2,Å, but diffracts X-rays poorly to about 4,Å with significant anisotropy. [source] Crystallization and preliminary crystallographic analysis of endonuclease VIII in its uncomplexed formACTA CRYSTALLOGRAPHICA SECTION D, Issue 8 2004Gali Golan The Escherichia coli DNA repair enzyme endonuclease VIII (EndoVIII or Nei) excises oxidized pyrimidines from damaged DNA substrates. It overlaps in substrate specificity with endonuclease III and may serve as a back-up for this enzyme in E. coli. The three-dimensional structure of Nei covalently complexed with DNA has been recently determined, revealing the critical amino-acid residues required for DNA binding and catalytic activity. Based on this information, several site-specific mutants of the enzyme have been tested for activity against various substrates. Although the crystal structure of the DNA-bound enzyme has been fully determined, the important structure of the free enzyme has not previously been analyzed. In this report, the crystallization and preliminary crystallographic characterization of DNA-free Nei are described. Four different crystal habits are reported for wild-type Nei and two of its catalytic mutants. Despite being crystallized under different conditions, all habits belong to the same crystal form, with the same space group (I222) and a similar crystallographic unit cell (average parameters a = 57.7, b = 80.2, c = 169.7,Å). Two of these crystal habits, I and IV, appear to be suitable for full crystallographic analysis. Crystal habit I was obtained by vapour diffusion using PEG 8000, glycerol and calcium acetate. Crystal habit IV was obtained by a similar method using PEG 400 and magnesium chloride. Both crystals are mechanically strong and stable in the X-ray beam once frozen under cold nitrogen gas. A full diffraction data set has recently been collected from a wild-type Nei crystal of habit I (2.6,Å resolution, 85.2% completeness, Rmerge = 9.8%). Additional diffraction data were collected from an Nei-R252A crystal of habit IV (2.05,Å resolution, 99.9% completeness, Rmerge = 6.0%) and an Nei-E2A crystal of habit IV (2.25,Å resolution, 91.7% completeness, Rmerge = 6.2%). These diffraction data were collected at 95,100 K using a synchrotron X-ray source and a CCD area detector. All three data sets are currently being used to obtain crystallographic phasing via molecular-replacement techniques. [source] Purification, crystallization and preliminary X-ray analysis of a ,-like calpainACTA CRYSTALLOGRAPHICA SECTION D, Issue 2 2003Gour P. Pal The X-ray structure of m-calpain in the absence of Ca2+ has been described, but it has not been possible to obtain sufficient ,-calpain for structure determination. Comparison of the two structures is of interest in attempting to understand their different Ca2+ requirements. Here, the crystallization in the absence of Ca2+ of an inactive mutant hybrid calpain (MW , 100,kDa), which contains 85% of the rat ,-calpain sequence and is well expressed in Escherichia coli, is described. The properties of this calpain in its active form and particularly its Ca2+ requirement are close to those expected for wild-type ,-calpain. Clusters of plate-shaped crystals were obtained by vapour diffusion with polyethylene glycol (Mr, 6000) as precipitating agent in the presence of detergent. The crystals diffract to a resolution of 2.7,Å at a synchrotron source. The space group is P21, with unit-cell parameters a = 72.7, b = 184.6, c = 86.3,Å, , = 100.7°. There are two molecules in the asymmetric unit, corresponding to a solvent content of 57.1%. [source] Metal-free MIRAS phasing: structure of apo-S100A3ACTA CRYSTALLOGRAPHICA SECTION D, Issue 8 2002Peer R. E. Mittl S100 proteins are involved in metal-dependent intracellular signalling. Metal-free S100A3, a cysteine-rich Ca2+ - and Zn2+ -binding protein, has been crystallized by vapour diffusion under the strict exclusion of oxygen and in the absence of divalent metal ions. Metal binding induces large conformational changes, rendering the apo-S100A3 crystals very sensitive to various metal compounds. Therefore, the structure was solved by MIRAS phasing using potassium iodide and xenon derivatives. Iodide replaces a water molecule at the surface of the S100A3 protein, whereas xenon binds in a hydrophobic cavity at the dimer interface. Despite significant non-isomorphism, the combination of both derivatives was sufficient for structure determination. The overall apo-S100A3 structure resembles the structures of metal-free S100B and S100A6 solution structures. In contrast to the NMR structures, the EF-hand loops are well ordered in the apo-S100A3 crystal structure. In the N-terminal pseudo-EF-hand loop a water molecule occupies the position of the Ca2+ ion. The C-terminal canonical EF-hand loop shows an extended conformation and a different helix arrangement to other S100/metal complex crystal structures. [source] Crystallization and preliminary X-ray study of an N-terminal fragment of rat liver ribosomal P2 proteinACTA CRYSTALLOGRAPHICA SECTION D, Issue 4 2002David Mandelman Ribosomal P proteins have been shown to be involved in the binding of elongation factors and participate in factor-dependent GTP hydrolysis. The P proteins form the pentamer (P1/P2)2,P0 constituting the lateral flexible stalk of the 60S ribosomal subunit. The highly soluble domain (1,65) of rat liver P2 has been overexpressed in Escherichia coli as an N-terminal poly-His-tagged protein and crystallized. To reduce nucleation and improve crystal morphology and diffraction power, the crystals were grown in a gel matrix and an oil barrier was added between the reservoir and the drop to reduce the rate of vapour diffusion. This dramatically reduced the nucleation in the drops and yielded diffraction-quality crystals. Data were collected to 2.4,Å resolution at beamline ID 14-1, ESRF. The crystals belong to the orthorhombic space group P21212, with unit-cell parameters a = 37.7, b = 96.7, c = 135.0,Å. [source] Crystallization and preliminary X-ray data of the recombinant peptide amidase from Stenotrophomonas maltophiliaACTA CRYSTALLOGRAPHICA SECTION D, Issue 2 2002Sebastian Neumann The peptide amidase from Stenotrophomonas maltophilia selectively hydrolyses the C-terminal amide bond in peptide amides. Crystals have been obtained by sitting-drop vapour diffusion from solution containing polyethylene glycol (PEG) 6000, HEPES pH 7.5, glycerine and sodium azide (NaN3). The crystals belong to the monoclinic space group P21, with unit-cell parameters a = 74.18, b = 62.60, c = 101.91,Å, , = 90°. X-ray data from these crystals diffracted at the European Synchrotron Radiation Facility (ESRF, France) ID14-1 beamline to 1.4,Å. [source] Crystallization and preliminary X-ray analysis of RecG, a replication-fork reversal helicase from Thermotoga maritima complexed with a three-way DNA junctionACTA CRYSTALLOGRAPHICA SECTION D, Issue 11 2001Martin R. Singleton The monomeric 3,-5, helicase RecG from the thermophilic bacterium Thermotoga maritima has been crystallized in complex with a three-way DNA junction, the preferred physiological substrate. The crystals were obtained by hanging-drop vapour diffusion. The crystals belong to space group C2, with unit-cell parameters a = 133.7, b = 144.6, c = 84.0,Å, , = 113.8°. Native data to a resolution of 3.25,Å were collected from crystals flash-cooled to 100,K. [source] Crystallization and preliminary X-ray analysis of UDP- N -acetylenolpyruvylglucosamine reductase (MurB) from Staphylococcus aureusACTA CRYSTALLOGRAPHICA SECTION D, Issue 7 2001Melissa S. Harris UDP- N -acetylenolpyruvylglucosamine reductase (MurB) is an essential enzyme in the bacterial cell-wall biosynthetic pathway, making it a potential therapeutic target for novel antibiotics. Diffraction-quality crystals of both the native and Se-methionine-expressed MurB from Staphylococcus aureus have been prepared by sitting-drop vapour diffusion from solutions containing polyethylene glycol (PEG) 8000, ammonium sulfate, sodium cacodylate pH 6.5 and dimethyl sulfoxide (DMSO). Crystals belong to the cubic space group I213, with unit-cell parameters a = b = c = 178.99,Å. X-ray data from these crystals were collected at the Advanced Photon Source 17-ID beamline and were used to solve the MurB structure to 2.3,Å resolution. [source] Crystallization and preliminary X-ray diffraction studies of phospholipase D from Streptomyces sp.ACTA CRYSTALLOGRAPHICA SECTION D, Issue 4 2000Ingar Leiros Crystals of purified phospholipase D (E.C. 3.1.4.4) from Streptomyces sp. strain PMF have been grown under two different crystallization conditions using vapour diffusion. Both conditions gave monoclinic crystals in space group P21. The unit-cell parameters were a = 57.28, b = 57.42, c = 68.70,Å, , = 93.17°. The crystals diffract at 110,K to a resolution beyond 1.4,Å using synchrotron radiation. [source] Crystallization and preliminary crystallographic studies of a new crystal form of Escherichia colil -asparaginase II (Ser58Ala mutant)ACTA CRYSTALLOGRAPHICA SECTION D, Issue 4 2000Maciej Kozak Periplasmic Escherichia colil -asparaginase II with an Ser58Ala mutation in the active-site cavity has been crystallized in a new orthorhombic form (space group P21212). Crystals of this polymorph suitable for X-ray diffraction have been obtained by vapour diffusion using two sets of conditions: (i) 1% agarose gel using MPD as precipitant (pH 4.8) and (ii) liquid droplets using PEG-MME 550 (pH 9.0). The crystals grown in agarose gel are characterized by unit-cell parameters a = 226.9, b = 128.4, c = 61.9,Å and diffract to 2.3,Å resolution. The asymmetric unit contains six protein molecules arranged into one pseudo-222-symmetric homotetramer and an active-site competent dimer from which another homotetramer is generated by crystallographic symmetry. [source] Crystallization and preliminary X-ray diffraction analysis of rat autotaxinACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 9 2010Jacqueline E. Day Rat autotaxin has been cloned, expressed, purified to homogeneity and crystallized via hanging-drop vapour diffusion using PEG 3350 as precipitant and ammonium iodide and sodium thiocyanate as salts. The crystals diffracted to a maximum resolution of 2.05,Å and belonged to space group P1, with unit-cell parameters a = 53.8, b = 63.3, c = 70.5,Å, , = 98.8, , = 106.2, , = 99.8°. Preliminary X-ray diffraction analysis indicated the presence of one molecule per asymmetric unit, with a solvent content of 47%. [source] Ein Trocknungskoeffizient für BaustoffeBAUPHYSIK, Issue 3 2009Gregor A. Scheffler Dr.-Ing. Berechnungsverfahren; Feuchte Wärme; Versuche Abstract Ein wesentliches Element der hygrothermischen Charakterisierung von Baustoffen ist der Trocknungsversuch. Im Gegensatz zu anderen Feuchtetransportexperimenten wie dem Diffusionsversuch oder dem Wasseraufnahmeexperiment ist es bislang nicht möglich, aus der Trocknung einen einfachen Kennwert abzuleiten. In vielen Fällen, beispielsweise in der Interaktion von Forschung und Industrie, aber auch beim praktischen Vergleich bzw. der Auswahl geeigneter Baustoffe wäre ein solcher Kennwert jedoch wünschenswert. Im vorliegenden Artikel wird zunächst die Bedeutung des Trocknungsversuches für die hygrische Charakterisierung von Baustoffen herausgestellt, aus der sich das Bestreben ableitet, das Trocknungsverhalten zu standardisieren und einen Einzahlen-Materialkennwert zu definieren. Nach einer die verschiedenen Einflussfaktoren der Trocknung differenzierenden Einleitung werden bestehende Ansätze für die Standardisierung des Trocknungsverlaufes bzw. die Ableitung eines Trocknungskoeffizienten vorgestellt. Die einhergehenden Probleme werden diskutiert und weitere Möglichkeiten evaluiert. Ein einfacher Trocknungskoeffizient, der sich aus dem Trocknungsverlauf ableiten lässt, wird definiert. Die Korrelation dieses Koeffizienten mit dem Wasseraufnahmekoeffizienten und dem Dampfdiffusionswiderstand wird analysiert. Sein zusätzlicher Informationsgehalt wird in diesem Zusammenhang kritisch hinterfragt. Im Ergebnis steht die Definition des Trocknungskoeffizienten als ein neuer, unabhängiger Materialkennwert, der die Feuchtetransporteigenschaften im Übergang zwischen hygroskopischem und gesättigtem Transport beschreibt. Mit diesem Kennwert ist es möglich, Baustoffe einfach und schnell hinsichtlich ihres Trocknungsverhaltens zu unterscheiden und zu beurteilen, was insbesondere bei feuchtesensitiven Materialien von Bedeutung ist. A drying coefficient for building materials. The drying experiment is an important element of the hygrothermal characterisation of building materials. Contrary to other moisture transport experiments as the vapour diffusion and the water absorption test, it is until now not possible to derive a simple coefficient for the drying. However, in many cases such a coefficient would be highly appreciated, e.g. in interaction of industry and research or for the distinction and selection of suitable building materials throughout design and practise. This article first highlights the importance of drying experiments for hygrothermal characterisation of building materials on which the attempt is based to standardize the drying experiment as well as to derive a single number material coefficient. The drying itself is briefly reviewed and existing approaches are discussed. On this basis, possible definitions are evaluated. Finally, a drying coefficient is defined which can be determined based on measured drying data. The correlation of this coefficient with the water absorption and the vapour diffusion coefficient is analyzed and its additional information content is critically challenged. As result, a drying coefficient has been derived and defined as a new and independent material parameter. It contains information about the moisture transport properties throughout the wide range of moisture contents from hygroscopic up to saturation. With this new and valuable coefficient, it is now possible to distinguish and select building materials quickly and easily by means of their drying behaviour. This is particularly important for moisture sensitive materials. [source] Crystallization and preliminary crystallographic analysis of the ADP-ribosyltransferase HopU1ACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 8 2010Yan Lin Several Gram-negative pathogens of plants and animals and some eukaryotic associated bacteria use type III protein-secretion systems (T3SSs) to deliver bacterial virulence-associated `effector' proteins directly into host cells. HopU1 is a type III effector protein from the plant pathogen Pseudomonas syringae, which causes plant bacterial speck disease. HopU1 quells host immunity through ADP-ribosylation of GRP7 as a substrate. HopU1 has been reported as the first ADP-ribosyltransferase virulence protein to be identified in a plant pathogen. Although several structures of ADP-ribosyltransferases have been determined to date, no structure of an ADP-ribosyltransferase from a plant pathogen has been determined. Here, the protein expression, purification, crystallization and preliminary crystallographic analysis of HopU1 are reported. Diffracting crystals were grown by hanging-drop vapour diffusion using polyethylene glycol 10,000 as a precipitant. Native and SAD data sets were collected using native and selenomethionine-derivative HopU1 crystals. The diffraction pattern of the crystal extended to 2.7,Å resolution using synchrotron radiation. The crystals belonged to space group P43, with unit-cell parameters a = 92.6, b = 92.6, c = 101.6,Å. [source] Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3,-terminusACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 5 2010Hyun Koo Yeo The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3,-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8,Å resolution. The oligonucleotide was crystallized at 277,K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34,Å, , = 91.37, , = 93.21, , = 92.35°. [source] Revisiting glutaraldehyde cross-linking: the case of the Arg,Lys intermolecular doubletACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 3 2010Michèle Salem In addition to the common use of glutaraldehyde to nonspecifically cross-link protein crystals through lysine residues disposed on the surface of the protein, the use of gentle vapour diffusion of glutaraldehyde offers a convenient way to limit polymerization and to allow slow diffusion throughout the crystal. In the case of trimeric barnase crystals, a specific cross-link was observed between an lysine side chain and an arginine side chain that were spatially disposed at the ideal distance on the protein surface in the three monomers. Here, the direct observation of a specific Lys,Arg cross-link site is reported and a mechanism is proposed for the reaction. [source] Purification and crystallization of the entire recombinant subunit E of the energy producer A1Ao ATP synthaseACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 3 2010Asha Manikkoth Balakrishna A1Ao ATP synthases are the major energy producers in archaea. Subunit E of the stator domain of the ATP synthase from Pyrococcus horikoshii OT3 was cloned, expressed and purified to homogeneity. The monodispersed protein was crystallized by vapour diffusion. A complete diffraction data set was collected to 3.3,Å resolution with 99.4% completeness using a synchrotron-radiation source. The crystals belonged to space group I4, with unit-cell parameters a = 112.51, b = 112.51, c = 96.25,Å, and contained three molecules in the asymmetric unit. [source] Crystallization and X-ray diffraction analysis of human CLEC5A (MDL-1), a dengue virus receptorACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 1 2010Aleksandra A. Watson The human C-type lectin-like protein CLEC5A (also known as MDL-1) is expressed on the surface of myeloid cells and plays a critical role in dengue-virus-induced disease by signalling through the transmembrane adaptor protein DAP12. The C-type lectin-like domain of CLEC5A was expressed in Escherichia coli, refolded and purified. Recombinant CLEC5A crystals were grown by sitting-drop vapour diffusion using polyethylene glycol 6000 as a precipitant. After optimization, crystals were grown which diffracted to 1.56,Å using synchrotron radiation. The results presented in this paper suggest that crystals producing diffraction of this quality will be suitable for structural determination of human CLEC5A. [source] Purification, crystallization and preliminary X-ray analysis of the PCNA2,PCNA3 complex from Sulfolobus tokodaii strain 7ACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 12 2009Akito Kawai Crenarchaeal PCNA is known to consist of three subunits (PCNA1, PCNA2 and PCNA3) that form a heterotrimer (PCNA123). Recently, another heterotrimeric PCNA composed of only PCNA2 and PCNA3 was identified in Sulfolobus tokodaii strain 7 (stoPCNAs). In this study, the purified stoPCNA2,stoPCNA3 complex was crystallized by hanging-drop vapour diffusion. The crystals obtained belonged to the orthorhombic space groups I222 and P21212, with unit-cell parameters a = 91.1, b = 111.8, c = 170.9,Å and a = 91.1, b = 160.6, c = 116.6,Å, respectively. X-ray diffraction data sets were collected to 2.90,Å resolution for the I222 crystals and to 2.80,Å resolution for the P21212 crystals. [source] Crystallization and preliminary X-ray analysis of eukaryotic initiation factor 4E from Pisum sativumACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 8 2009Jamie A. Ashby Crystals of an N-terminally truncated 20,kDa fragment of Pisum sativum eIF4E (,N-eIF4E) were grown by vapour diffusion. X-ray data were recorded to a resolution of 2.2,Å from a single crystal in-house. Indexing was consistent with primitive monoclinic symmetry and solvent-content estimations suggested that between four and nine copies of the eIF4E fragment were possible per crystallographic asymmetric unit. eIF4E is an essential component of the eukaryotic translation machinery and recent studies have shown that point mutations of plant eIF4Es can confer resistance to potyvirus infection. [source] Crystallization and preliminary X-ray analysis of a complex formed between the antibiotic simocyclinone D8 and the DNA breakage,reunion domain of Escherichia coli DNA gyraseACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 8 2009Marcus J. Edwards Crystals of a complex formed between the 59,kDa N-terminal fragment of the Escherichia coli DNA gyrase A subunit (also known as the breakage,reunion domain) and the antibiotic simocyclinone D8 were grown by vapour diffusion. The complex crystallized with I -centred orthorhombic symmetry and X-ray data were recorded to a resolution of 2.75,Å from a single crystal at the synchrotron. DNA gyrase is an essential bacterial enzyme and thus represents an attractive target for drug development. [source] Crystallization of the flexible nuclear import receptor importin-, in the unliganded stateACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 6 2009Noelia Roman The transport of macromolecules across the nuclear envelope is an essential eukaryotic process that enables proteins such as transcription factors, polymerases and histones to gain access to the genetic material contained within the nucleus. Importin-, plays a central role in the nucleocytoplasmic transport process, mediating nuclear import through a range of interactions with cytoplasmic, nuclear and nuclear pore proteins such as importin-,, Ran, nucleoporins and various cargo molecules. The unliganded form of the full-length yeast importin-, has been expressed and crystallized. The crystals were obtained by vapour diffusion at pH 6.5 and 290,K. The crystals belonged to space group P21 (unit-cell parameters a = 58.17, b = 127.25, c = 68.52,Å, , = 102.23). One molecule is expected in the asymmetric unit. The crystals diffracted to 2.4,Å resolution using a laboratory X-ray source and were suitable for crystal structure determination. [source] Crystallization and preliminary X-ray diffraction analysis of the lectin from Canavalia boliviana Piper seedsACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 3 2009Tales Rocha Moura Plant lectins are the most studied group of carbohydrate-binding proteins. Despite the high similarity between the members of the Diocleinae subtribe (Leguminosae) group, they present differing biological activities. Canavalia boliviana lectin (Cbol) was purified using a Sephadex G-50 column and crystallized in the presence of X-Man by hanging-drop vapour diffusion at 293,K. After optimization, crystals suitable for diffraction were obtained under the condition 0.1,M HEPES pH 7.5 and 3.0,M sodium formate. The crystal belonged to the monoclinic space group C2, with unit-cell parameters a = 126.70, b = 66.64, c = 64.99,Å, , = 90.0, , = 120.8, , = 90.0°. Assuming the presence of a dimer in the asymmetric unit, the solvent content was estimated to be about 46%. A complete data set was collected at 1.5,Å resolution. [source] | |||||||||||||