Home About us Contact
|
Home About us Contact | ||
|
|
||
UPGMA Method (upgma + method)
Selected AbstractsComparative Ant Faunas between Seonyudo and Seven Other Islands of West Sea in KoreaENTOMOLOGICAL RESEARCH, Issue 2 2002So-Jin HA ABSTRACT This paper is intended as an investigation of the biogeographic characteristics of ant faunas of the eight islands in West Sea of South Korea, using quantitative genetic analyses. The faunal similarity is examined using the Nomura-Simpson's Coefficient (NSC). The obtained NSC value matrix was examined by a cluster analysis using UPGMA method. The MSC-values between the seven areas investigated range from 0.500 (Deokjeokdo Hongdo) to 0.909 (Wonsando-Hongdo). In these islands including Seonyudo, the NSC -values range from 0.571 (Deokjeokdo) to 0.778 (Bigeumdo). The cluster analysis using the similarity index (NSC) showed that eight islands were divided into two groups at the level of 41%. It was shown that Wonsando and Bigeumdo were closer (Similarity = 83%) than those between others. Deokjeokdo and Bigeumdo were remote (Similarity = 41%) from each conspecific population. That is, the species composition of Bigeumdo (Similarity = 70%) was similar to that of the Seonyudo, while that of Deokjeokdo (Similarity = 41%) was different from that. [source] Faunal Comparison of Ants among Cheongsando and Other Islands of South Sea in KoreaENTOMOLOGICAL RESEARCH, Issue 1 2002Seong-Joon PARK ABSTRACT This paper attempts to reveal the biogeographic characteristics of ant fauna of the islands among Korean South Sea, using quantitative analyses. The data treated in this paper are those from Cheongsando Is. and 10 other islands in South Sea which have been well investigated. The faunal similarity is examined using the Nomura-Simpson's Coefficient (NSC). Futhermore, the obtained NSC value matrix is examined by a cluster analysis using UPGMA method. The number of species which has been recorded in the 11 islands are 91 species belonging to 34 genera under 4 subfamilies. Among the above 11 islands, Jejudo Is., which is the largest, has the highest number of species, 67 spp., while Geogeumdo Is. has the lowest, 21 spp. Cheongsando Is. which has directly been investigated by authors has 30 species. The NSC- values between the 11 localities investigated range from 0.522 (Wando Is. to Saryangdo Is.) to 1.000 (Namhaedo Is. to Geojedo Is.). The comparative NSC value of Cheongsando Is. and 10 islands range from 0.522 (to Saryangdo Is.) to 0.833 (to Jejudo Is). The cluster analysis using a similarity index (NSC) showed that the islands of these areas could be grouped into 3, a level of 32%. The similarity of Soando Is. and Geomundo Is. were the closest, 63%, while Soando Is. and Namhaedo Is. were the remotest, 32%. The similarity of Jindo Is. and Cheongsando Is, was 63%, while that of Namhaedo Is. and Cheongsando Is. was 32%. [source] URP-based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of WheatJOURNAL OF PHYTOPATHOLOGY, Issue 4 2010Rashmi Aggarwal Abstract Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs') are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5,GTGTGCGATCAGTTGCTGGG3,) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. [source] Surnames in Siberia: A study of the population of Yakutia through isonymyAMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY, Issue 2 2009L. Tarskaia Abstract We studied the isonymic structure of the Republic of Sakha (Yakutia), in the Russian Federation, using the surname distributions of 491,259 citizens above 18 years registered as residents in 2002. These were distributed in 35 districts and 497 towns and settlements of the Republic. The number of different surnames was 44,625. Matrices of isonymic distances between the 35 districts were tested for correlation with the geographic distance between the population centers of gravity of thedistricts. We found that, for the whole of Yakutia, Nei's distance was correlated with geographic distance (r = 0.693 ± 0.027). A dendrogram of the 35 districts was built from the distance matrix, using the UPGMA method. The clusters identified by the dendrogram correlate with the geographic position of the districts. The correlation of random inbreeding calculated from isonymy, FST, with latitude was positive and highly significant but weak (r = 0.23). So, inbreeding was highest in the Arctic districts, and lowest in the South. Average , for 497 towns was 107, for 35 districts it was 311, and for the Republic 433. The value of , was higher for Russian than for the local languages. The geographical distribution of ,, high in the Center and South-East and lower in the North-West, is compatible with the settlement of groups of migrants moving from the South-East toward the center and the North of Yakutia. It is proposed that low-density demic diffusion of human populations results in high inbreeding and may have been a general phenomenon in the early phases of human radiations. Am J Phys Anthropol 2009. © 2008 Wiley-Liss, Inc. [source] A comparative assessment of molecular marker assays (AFLP, RAPD and SSR) for white yam (Dioscorea rotundata) germplasm characterizationANNALS OF APPLIED BIOLOGY, Issue 3 2003H D MIGNOUNA Summary Several DNA-based marker systems are available for genetic fingerprinting of plants but information on their relative usefulness for yam germplasm characterisation is lacking. The efficiency of RAPD, AFLP and SSR markers for the assessment of genetic relationships, and for cultivar identification and discrimination among 45 West and Central African white yam cultivars belonging to 22 morphotypes/cultivar groups was investigated. Dendrograms were produced based on band pattern scores using the UPGMA method. Results showed that each of the three techniques could unequivocably identify each cultivar, but that techniques differed in the mean number of profiles generated per primer (or primer pair) per cultivar, referred to as genotype index (GI). The order of merit based on this criterion in this study was AFLPs (GI = 2.56), SSRs (GI = 0.39) and RAPDs (GI = 0.35). Yam genotypes classified in the same cultivar group based on morphology were often genetically different, emphasising the need for molecular fingerprinting in yam germplasm characterisation. AFLPs showed the highest efficiency in detecting polymorphism and revealed genetic relationships that most closely reflected morphological classification. [source] | ||||||||||