Home About us Contact
|
Home About us Contact | ||
|
|
||
Sitting-drop Vapour Diffusion (sitting-drop + vapour_diffusion)
Selected AbstractsStructure of the mexicain,E-64 complex and comparison with other cysteine proteases of the papain familyACTA CRYSTALLOGRAPHICA SECTION D, Issue 5 2007J. A. Gavira Mexicain is a 23.8,kDa cysteine protease from the tropical plant Jacaratia mexicana. It is isolated as the most abundant product after cation-exchange chromatography of the mix of proteases extracted from the latex of the fruit. The purified enzyme inhibited with E-64 [N -(3-carboxyoxirane-2-carbonyl)-leucyl-amino(4-guanido)butane] was crystallized by sitting-drop vapour diffusion and the structure was solved by molecular replacement at 2.1,Å resolution and refined to an R factor of 17.7% (Rfree = 23.8%). The enzyme belongs to the ,+, class of proteins and the structure shows the typical papain-like fold composed of two domains, the ,-helix-rich (L) domain and the ,-barrel-like (R) domain, separated by a groove containing the active site formed by residues Cys25 and His159, one from each domain. The four monomers in the asymmetric unit show one E-64 molecule covalently bound to Cys25 in the active site and differences have been found in the placement of E-64 in each monomer. [source] Crystallization and preliminary X-ray data of the recombinant peptide amidase from Stenotrophomonas maltophiliaACTA CRYSTALLOGRAPHICA SECTION D, Issue 2 2002Sebastian Neumann The peptide amidase from Stenotrophomonas maltophilia selectively hydrolyses the C-terminal amide bond in peptide amides. Crystals have been obtained by sitting-drop vapour diffusion from solution containing polyethylene glycol (PEG) 6000, HEPES pH 7.5, glycerine and sodium azide (NaN3). The crystals belong to the monoclinic space group P21, with unit-cell parameters a = 74.18, b = 62.60, c = 101.91,Å, , = 90°. X-ray data from these crystals diffracted at the European Synchrotron Radiation Facility (ESRF, France) ID14-1 beamline to 1.4,Å. [source] Crystallization and preliminary X-ray analysis of UDP- N -acetylenolpyruvylglucosamine reductase (MurB) from Staphylococcus aureusACTA CRYSTALLOGRAPHICA SECTION D, Issue 7 2001Melissa S. Harris UDP- N -acetylenolpyruvylglucosamine reductase (MurB) is an essential enzyme in the bacterial cell-wall biosynthetic pathway, making it a potential therapeutic target for novel antibiotics. Diffraction-quality crystals of both the native and Se-methionine-expressed MurB from Staphylococcus aureus have been prepared by sitting-drop vapour diffusion from solutions containing polyethylene glycol (PEG) 8000, ammonium sulfate, sodium cacodylate pH 6.5 and dimethyl sulfoxide (DMSO). Crystals belong to the cubic space group I213, with unit-cell parameters a = b = c = 178.99,Å. X-ray data from these crystals were collected at the Advanced Photon Source 17-ID beamline and were used to solve the MurB structure to 2.3,Å resolution. [source] Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3,-terminusACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 5 2010Hyun Koo Yeo The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3,-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8,Å resolution. The oligonucleotide was crystallized at 277,K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34,Å, , = 91.37, , = 93.21, , = 92.35°. [source] Crystallization and X-ray diffraction analysis of human CLEC5A (MDL-1), a dengue virus receptorACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 1 2010Aleksandra A. Watson The human C-type lectin-like protein CLEC5A (also known as MDL-1) is expressed on the surface of myeloid cells and plays a critical role in dengue-virus-induced disease by signalling through the transmembrane adaptor protein DAP12. The C-type lectin-like domain of CLEC5A was expressed in Escherichia coli, refolded and purified. Recombinant CLEC5A crystals were grown by sitting-drop vapour diffusion using polyethylene glycol 6000 as a precipitant. After optimization, crystals were grown which diffracted to 1.56,Å using synchrotron radiation. The results presented in this paper suggest that crystals producing diffraction of this quality will be suitable for structural determination of human CLEC5A. [source] | ||||||||||