Second Cluster (second + cluster)

Distribution by Scientific Domains


Selected Abstracts


URP-based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

JOURNAL OF PHYTOPATHOLOGY, Issue 4 2010
Rashmi Aggarwal
Abstract Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs') are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5,GTGTGCGATCAGTTGCTGGG3,) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. [source]


TlpC, a novel chemotaxis protein in Rhodobacter sphaeroides, localizes to a discrete region in the cytoplasm

MOLECULAR MICROBIOLOGY, Issue 5 2002
G. H. Wadhams
Summary TlpC is encoded in the second chemotaxis operon of Rhodobacter sphaeroides. This protein shows some homology to membrane-spanning chemoreceptors of many bacterial species but, unlike these, is essential for R. sphaeroides chemotaxis to all compounds tested. Genomic replacement of tlpC with a C-terminal gfp fusion demonstrated that TlpC localized to a discrete cluster within the cytoplasm. Immunogold electron microscopy also showed that TlpC localized to a cytoplasmic electron-dense region. Correct TlpC,GFP localization depended on the downstream signalling proteins, CheW3, CheW4 and CheA2, and was tightly linked to cell division. Newly divided cells contained a single cluster but, as the cell cycle progressed, a second cluster appeared close to the initial cluster. As elongation continued, these clusters moved apart so that, on septation, each daughter cell contained a single TlpC cluster. The data presented suggest that TlpC is either a cytoplasmic chemoreceptor responding to or integrating global signals of metabolic state or a novel and essential component of the chemotaxis signalling pathway. These data also suggest that clustering is essential for signalling and that a mechanism may exist for targeting and localizing proteins within the bacterial cytoplasm. [source]


New Worlds in Political Science

POLITICAL STUDIES, Issue 2 2010
Patrick Dunleavy
,Political science' is a ,vanguard' field concerned with advancing generic knowledge of political processes, while a wider ,political scholarship' utilising eclectic approaches has more modest or varied ambitions. Political science nonetheless necessarily depends upon and is epistemologically comparable with political scholarship. I deploy Boyer's distinctions between discovery, integration, application and renewing the profession to show that these connections are close woven. Two sets of key challenges need to be tackled if contemporary political science is to develop positively. The first is to ditch the current unworkable and restrictive comparative politics approach, in favour of a genuinely global analysis framework. Instead of obsessively looking at data on nation states, we need to seek data completeness on the whole (multi-level) world we have. A second cluster of challenges involves looking far more deeply into political phenomena; reaping the benefits of ,digital-era' developments; moving from sample methods to online census methods in organisational analysis; analysing massive transactional databases and real-time political processes (again, instead of depending on surveys); and devising new forms of ,instrumentation', informed by post-rational choice theoretical perspectives. [source]


Mutational analysis of SPANX genes in families with X-Linked prostate cancer

THE PROSTATE, Issue 8 2007
Natalay Kouprina
Abstract BACKGROUND Previous genetic linkage studies identified a locus for susceptibility to prostate cancer called HPCX at Xq27. The candidate region contains two clusters of SPANX genes. The first cluster called SPANX-A/D includes SPANX - A1, SPANX-A2, SPANX-B, SPANX-C, and SPANX-D; the second cluster called SPANX-N includes SPANX-N1, SPANX-N2, SPANX-N3, and SPANX-N4. The SPANX genes encode cancer-testis (CT) specific antigens. Previous studies identified SPANX-B and SPANX-D variants produced by gene conversion events, none of which are associated with X-linked prostate cancer. METHODS In this study we applied transformation-associated recombination cloning (TAR) in yeast to analyze sequence variations in SPANX - A1, SPANX - A2, and SPANX - C genes that are resided within large chromosomal duplications. A SPANX-N1/N4 cluster was analyzed by a routine PCR analysis. RESULTS None of the sequence variations in the coding regions of these genes is associated with susceptibility to prostate cancer. CONCLUSIONS Therefore, genetic variation in the SPANX genes is not the actual target variants explaining HPCX. However, it is possible that they play a modifying role in susceptibility to prostate cancer through complex recombinational interaction. Prostate 67: 820,828, 2007. © 2007 Wiley-Liss, Inc. [source]


Population genetic structure of sea cucumber, Stichopus japonicus in Korea using microsatellite markers

AQUACULTURE RESEARCH, Issue 10 2008
Mi-Jung Kim
Abstract Sea cucumber (Stichopus japonicus) is a commercially valuable species in Korea. We examined the genetic characteristics of sea cucumber populations in Korea using microsatellite markers. A total of 144 sea cucumbers from five populations were typed for nine polymorphic microsatellite loci. A total of 139 different alleles were found over all loci and many alleles were unique. The average number of allele per locus ranged from 6 to 18.4. The average observed and expected heterozygosities ranged from 0.532 to 0.626 and from 0.719 to 0.789 respectively. All populations showed significant departure from Hardy,Weinberg equilibrium at almost all loci except one (Psj2409). This deviation was in the direction of heterozygote deficit. A phylogenetic tree revealed two distinct clusters. One cluster was formed by the eastern sea population. A second cluster consisted of the subpopulations of the western and southern sea populations. The eastern sea population showed genetic differences such as a larger number of alleles per locus, a larger number of unique alleles and a smaller number of the most common alleles, suggesting a higher genetic diversity in this population. These results provide basic information on natural population genetic structure of S. japonicus in Korea. [source]


Managing the hinterland beyond: Two ideal-type strategies of economic development for small island territories

ASIA PACIFIC VIEWPOINT, Issue 1 2006
Godfrey BaldacchinoArticle first published online: 30 MAR 200
Abstract: Rarely does one come across critical analysis which looks at islands as the strategic and candid promoters of a role as political and economic usufructuaries over external resources. This paper is premised on the proposition that a small territory is especially obliged to use extra-territorial resources as its hinterland for economic success. Such resources extend over a whole range of goods and services and include access to investment, welfare, security, stable currency, international relations, specialised labour power, transfers, markets and higher education. The MIRAB syndrome is one way of articulating this condition. This paper proposes a second cluster of features that are, or can be, deployed by small territories in a manner somewhat different from MIRAB; this second cluster has a more proactive policy orientation and a disposition towards carving out procedural and jurisdictional powers. It is thus proposed to consider a small territory's engagement with the external hinterland as a position on a sliding scale, a strategic mix of options located between two distinct development trajectories, of which MIRAB is one and the PROFIT model the other. [source]