Home About us Contact
|
Home About us Contact | ||
|
|
||
Pair Group Method (pair + group_method)
Kinds of Pair Group Method Selected AbstractsAmplified fragment length polymorphism (AFLP) and biochemical typing of Photobacterium damselae subsp. damselaeJOURNAL OF APPLIED MICROBIOLOGY, Issue 4 2002S. Botella Aims: The aim of the present study was to characterize subspecifically Photobacterium damselae subsp. damselae strains isolated from cultured Sparus aurata and Dicentrarchus labrax by means of phenotypic and molecular typing techniques (amplified fragment length polymorphism, AFLP). Methods and Results: Seventy-one strains of P. damselae subsp. damselae were isolated from 38 cultured fishes at different fish farms located on the Mediterranean coast near Valencia, Spain. Most fish studied were asymptomatic and some were recovered during infectious outbreaks. Phenotypic characterization revealed a considerable degree of variability within the subspecies, including some characters, such as production of urease, which are used to differentiate P. damselae subsp. damselae from P. damselae subsp. piscicida. Genetic characterization was conducted on a selection of 33 strains, including two reference strains. Dice coefficient (Sd) and the unweighted pair group method with average linkage (UPGMA) were used for numerical analysis of banding patterns. AFLP type was defined on the basis of 100% similarity in the dendrogram obtained, yielding 24 distinct AFLP profiles. At 70% similarity, 13 clusters were defined, thus confirming the great variability observed for the phenotypic traits. Conclusions: The AFLP variability shown by the isolates was high enough to discriminate between different strains which colonize the same fish. However, closely related AFLP types were usually derived from strains isolated at the same fish farm, indicating an epidemiological relationship. Significance and Impact of the Study: This study has confirmed that the AFLP technique allows discrimination of individual strains within P. damselae subsp. damselae for epidemiological studies, and that this subspecies exhibits greater variability than that described for subspecies piscicida. [source] URP-based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of WheatJOURNAL OF PHYTOPATHOLOGY, Issue 4 2010Rashmi Aggarwal Abstract Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs') are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5,GTGTGCGATCAGTTGCTGGG3,) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. [source] AFLP analysis of genetic variability among Stylosanthes guianensis accessions resistant and susceptible to the stylo anthracnosePLANT BREEDING, Issue 6 2005C.-S. Jiang Abstract Stylosanthes guianensis, belonging to the genus Stylosanthes, is one of the most important tropical forage legumes and is native to South and Central America and Africa. Anthracnose, caused by the fungus Colletotrichum gloeosporioides (Penz.) Sacc., is a major constraint to the extensive use of Stylosanthes as tropical forage. Forty-two accessions of S. guianensis were assessed with amplified fragment length polymorphism (AFLP) for genetic diversity and for resistance to anthracnose. In AFLP analysis, four selective primer combinations screened from 96 primer combinations were used to analyse these accessions, and a total of 225 clear bands were used for genetic similarity (GS) analysis, showing a 95.5% level of polymorphism on average. GS from 31.0% to 95.0% among the accessions was calculated with ntsys -pc software. The dendrogram was constructed with unweighted pair group method of averages (UPGMA) based on the AFLP data, and five clusters were defined at 48% GS. Two typical strains of C. gloeosporioides from Stylosanthes in China were used for anthracnose resistance screening. Most of the plant accessions showed variation in the reaction to two strains, and the correlation of resistance had a value of 0.904 (P < 0.01), suggesting common resistance to the two strains. The resistance accessions were randomly distributed in different groups of UPGMA clustering. These results demonstrate that AFLP analysis is an efficient method for evaluating the genetic diversity among S. guianensis accessions. [source] Application of random amplified polymorphic DNA and inter-simple sequence repeat markers in the genus CrataegusANNALS OF APPLIED BIOLOGY, Issue 2 2009H. Dai Abstract Hawthorn (Crataegus spp.) has a long history as an ornamental and a source of medicine. We report the use of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) markers to determine genetic relationships in the genus Crataegus. Twenty-eight accessions, including eight species (Crataegus pinnatifida, Crataegus bretschneideri, Crataegus maximowiczii, Crataegus kansuensis, Crataegus altaica, Crataegus songarica, Crataegus dahurica and Crataegus sanguinea) and two botanical varieties (C. pinnatifida var. major and C. maximowiczii var. ninganensis) were analysed. Twelve RAPD primers reproducibly and strongly amplified 128 fragments of which 116 were polymorphic; similarly, 13 ISSR primers generated 127 products of which 119 were polymorphic. Dendrograms based on unweighted pair group method with arithmetic average analysis were constructed from both the RAPD and the ISSR data. Similarity coefficient based on RAPD and ISSR markers ranged from 0.22 to 0.98 and 0.23 to 0.98, respectively. The range in similarity coefficient indicated that the genus has a high level of genetic diversity. The Mantel test on the similarity matrices produced by RAPD and ISSR markers gave r = 0.86, showing high correlation between RAPD and ISSR markers in their ability to detect genetic relationships between Crataegus accessions. RAPD and ISSR appear to be reliable methods for the analysis of genetic relationships among hawthorns. [source] Genetic diversity in a collection of old and new bread wheat cultivars from Iran as revealed by simple sequence repeat-based analysisANNALS OF APPLIED BIOLOGY, Issue 1 2009S.A. Mohammadi Abstract Genetic diversity in a collection of 70 bread wheat (Triticum aestivum) genotypes was studied using 73 microsatellite [simple sequence repeat (SSR)] loci evenly spaced on wheat chromosomes. A total of 592 alleles with an average of 8.53 allele/locus were detected, of which 185 (31.25%) occurred only in a specific group of genotypes. A set of SSR markers consisted of 22 loci with polymorphic information content values of 0.80 or higher were selected for rapid fingerprinting of many genotypes. Average of gene diversity was 0.74 ± 0.017, and significant difference between observed and maximum theoretical values of gene diversity in the analysed SSR loci was obtained using a paired t -test. Genetic distance-based clustering methods including unweighted pair group method with arithmetic average and neighbour joining (NJ) were used for grouping of genotypes. The resulted dendrogram based on NJ and number of differences coefficient hinted of the existence of three groups. This grouping was in agreement with the pedigree information and confirmed by high within-group bootstrap value. A comparatively higher genetic diversity in the studied wheat collection as revealed by presence of high allelic diversity and large number of specific alleles could be utilised in development of new cultivars with desired characteristics. [source] Polymorphic analysis of microsatellite DNA in wild populations of Chinese shrimp (Fenneropenaeus chinensis)AQUACULTURE RESEARCH, Issue 6 2006Ping Liu Abstract Primers were designed for eight microsatellite loci from Chinese shrimp Fenneropenaeus chinensis. Microsatellites were used to characterize three wild populations from the China coast of the Yellow and Bohai Seas (HB), and the west coast (KX) and south coast of the Korean Peninsula (KN). A total of sixty-one alleles were obtained, and the average observed heterozygosity ranged from 0.660 to 0.756. Six of the 24 population-locus cases showed a significant departure from the Hardy,Weinberg equilibrium, three of them from population KN, two from KX and one from HB. The Fst values indicated that genetic variation was greater within populations than between populations. Analysis using unweighted pair group method with arithmetic mean showed that the relationship between populations HB and KX was closer than between KN and the other two populations. Polymorphic information contents of the eight microsatellites ranged from 0.598 to 0.918. These results indicated that all eight microsatellite loci would be useful for the analysis of genetic variation in Chinese shrimp (F. chinensis) populations. [source] Genetic differentiation among the Maculinea species (Lepidoptera: Lycaenidae) in eastern Central EuropeBIOLOGICAL JOURNAL OF THE LINNEAN SOCIETY, Issue 1 2007KATALIN PECSENYE The present study aimed to analyse the level of genetic variation in the eastern Central European (Slovenia, Hungary, and Romania/Transylvania) populations of the Large Blues (Maculinea) to analyse the pattern of differentiation both between and within the species. One objective was to compare the level of differentiation between the two disputed species (Maculinea alcon and Maculinea rebeli) with that among the other species. Imagos were collected from 23 localities in eastern Central Europe in 2002. Enzyme polymorphism was analysed using polyacrylamide gel electrophoresis. Fourteen enzyme loci were studied in all samples. In the analysis of the data, F -statistics and Nei's genetic distances were calculated and a dendrogram (unweighted pair group method with arithmetic mean) was constructed on the basis of the distance matrix. A multivariate analysis of variance was performed to study the pattern of genetic differentiation among the samples. Principal component analysis analysis was also carried out using the allele frequency data of the samples. Our results indicated that the large blues are generally less polymorphic than other European lycaenid butterflies studied. At the same time, the level of genetic differentiation was high, even among local populations within the species. A low level of genetic variation within the populations coupled with strong differentiation among them implies the effect of genetic drift. Strong genetic differentiation of four Maculinea species (M. alcon, Maculinea teleius, Maculinea nausithous, and Maculinea arion) was confirmed. Significant differentiation was not found between M. alcon and M. rebeli. © 2007 The Linnean Society of London, Biological Journal of the Linnean Society, 2007, 91, 11,21. [source] | ||||||||||