Home About us Contact
|
Home About us Contact | ||
|
|
||
Arithmetic Averages (arithmetic + average)
Selected AbstractsGenetic Relationship of Pyrenophora graminea, P. teres f. maculata and P. teres f. teres Assessed by RAPD AnalysisJOURNAL OF PHYTOPATHOLOGY, Issue 2 2007J. Bakonyi Abstract Barley-pathogenic Pyrenophora isolates are P. graminea (PG), P. teres f. maculata (PTM) and P. teres f. teres (PTT), which cause foliar leaf stripe, spot blotch and net blotch lesions, respectively. However, the species are often indistinguishable by morphological and cultural characteristics. Random amplified polymorphic DNA (RAPD) analysis has been used to study the genetic relationship amongst 11 PG, 9 PTM and 23 PTT isolates from distant geographical locations. Using seven primers, 55 (52.38%) polymorphic DNA bands were detected out of 105 different fragments amplified in the three pathogens. Genotypic diversity was high as all but two PTT strains had distinct multilocus RAPD fingerprints. Unweighted pair-group method with arithmetic average (UPGMA) clustering separated the isolates into three main clusters, corresponding to the three pathogens studied. No clear geographical substructuring was found. Nei's gene diversity analysis detected only small differences (max. 6.6%) in band frequencies but considerable levels of differentiation were observed among the pathogen species/forms. However, the variability among the Pyrenophora species/forms (max. 42.0%) was less than within species/forms (max. 58%). Nei's unbiased genetic distance values were in agreement with UPGMA clustering and gene diversity analysis: the two forms of P. teres showed higher divergence from one another (D = 0.132) than the distance found between PG and PTM (D = 0.094). The results suggest that the present taxonomical classification of these morphological taxa may not correspond to their phylogenetic relationship and that there is a very close genetic relationship amongst barley-pathogenic Pyrenophora species, but genetic exchanges between them could be infrequent. [source] Expiration-day effects,An Asian twistTHE JOURNAL OF FUTURES MARKETS, Issue 5 2009Joseph K. W. Fung This study examines the intraday trading activities of index stocks on the common expiration day of index derivatives. In Hong Kong, index futures and index options use an Asian-style settlement procedure. All contracts are settled against the estimated average settlement price, an arithmetic average of the underlying cash index taken every five minutes on the expiration day. Trading volume and total trade count on the expiration day are both found to be higher than normal. Most important, trading intensifies in terms of volume and frequency close to the five-minute time marks. The study does not find significant price reversal and price compression patterns. Although significant order imbalance pattern is found on some expiration days, the results show no association between order imbalance pattern and the next-day return. © 2009 Wiley Periodicals, Inc. Jrl Fut Mark 28:430,450, 2009 [source] Genetic diversity in a collection of old and new bread wheat cultivars from Iran as revealed by simple sequence repeat-based analysisANNALS OF APPLIED BIOLOGY, Issue 1 2009S.A. Mohammadi Abstract Genetic diversity in a collection of 70 bread wheat (Triticum aestivum) genotypes was studied using 73 microsatellite [simple sequence repeat (SSR)] loci evenly spaced on wheat chromosomes. A total of 592 alleles with an average of 8.53 allele/locus were detected, of which 185 (31.25%) occurred only in a specific group of genotypes. A set of SSR markers consisted of 22 loci with polymorphic information content values of 0.80 or higher were selected for rapid fingerprinting of many genotypes. Average of gene diversity was 0.74 ± 0.017, and significant difference between observed and maximum theoretical values of gene diversity in the analysed SSR loci was obtained using a paired t -test. Genetic distance-based clustering methods including unweighted pair group method with arithmetic average and neighbour joining (NJ) were used for grouping of genotypes. The resulted dendrogram based on NJ and number of differences coefficient hinted of the existence of three groups. This grouping was in agreement with the pedigree information and confirmed by high within-group bootstrap value. A comparatively higher genetic diversity in the studied wheat collection as revealed by presence of high allelic diversity and large number of specific alleles could be utilised in development of new cultivars with desired characteristics. [source] The Mean of the Inverse of a Punctured Normal Distribution and Its ApplicationBIOMETRICAL JOURNAL, Issue 4 2004C. D. Lai Abstract The fundamental properties of a punctured normal distribution are studied. The results are applied to three issues concerning X/Y where X and Y are independent normal random variables with means ,X and ,Y respectively. First, estimation of ,X/,Y as a surrogate for E(X/Y) is justified, then the reason for preference of a weighted average, over an arithmetic average, as an estimator of ,X/,Y is given. Finally, an approximate confidence interval for ,X/,Y is provided. A grain yield data set is used to illustrate the results. (© 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim) [source] URP-based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of WheatJOURNAL OF PHYTOPATHOLOGY, Issue 4 2010Rashmi Aggarwal Abstract Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs') are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5,GTGTGCGATCAGTTGCTGGG3,) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. [source] Genetic relationships of sesame germplasm collection as revealed by inter-simple sequence repeatsPLANT BREEDING, Issue 3 2002D. H. Kim Abstract Inter-simple sequence repeats (ISSR) polymorphism was used to determine genetic relationships among 75 Sesamum indicum L. accessions of Korean and exotic sesame. Fourteen reliable ISSR primers were selected for the assessment of genetic diversity, yielding 79 amplification products. Of these polymerase chain reaction products, 33% revealed polymorphism among the 75 accessions. Genetic distances ranged from 0 to 0.255, with a mean genetic distance of 0.0687. The 75 accessions were divided into seven groups on the basis of unweighted pair-group method with arithmetic averages (UPGMA) cluster analysis. The largest group consisted of 25 Korean cultivars, eight Korean breeding lines and 17 world-wide accessions. The other groups included 25 accessions, several of which contained useful traits. The dendrogram did not indicate any clear division among sesame accessions based on their geographical origin. However, all Korean sesame cultivars except ,Namsankkae' were clustered in the same group, indicating a narrow gene pool. Some of the Korean breeding lines were spread along the dendrogram, showing enlargement of genetic diversity. The genetic diversity data uncovered in this study can be used in future breeding programmes. [source] GMM Repeat Sales Price IndicesREAL ESTATE ECONOMICS, Issue 2 2002Liang Peng Illiquid assets are widely spread within the economy but their indices are difficult to measure. This paper proposes a Generalized Method of Moment (GMM) repeat sales regression for estimating illiquid asset price indices. This method has estimators that are arithmetic averages of individual asset returns. This method is able to estimate custom-weighted indices, including equal- and value-weighted indices. It can incorporate hedonic variables to improve estimation accuracy, and it can work with a reweighting technique to mitigate a biased sample problem. Simulations based on artificial markets indicate that the method is more accurate than some alternatives in both efficient and sluggish markets, with and without temporal aggregation. As an application, we use this method to estimate a commercial property price index. [source] The Bias of the RSR Estimator and the Accuracy of Some AlternativesREAL ESTATE ECONOMICS, Issue 1 2002William N. Goetzmann This paper analyzes the implications of cross-sectional heteroskedasticity in the repeat sales regression (RSR). RSR estimators are essentially geometric averages of individual asset returns because of the logarithmic transformation of price relatives. We show that the cross-sectional variance of asset returns affects the magnitude of the bias in the average return estimate for each period, while reducing the bias for the surrounding periods. It is not easy to use an approximation method to correct the bias problem. We suggest an unbiased maximum likelihood alternative to the RSR that directly estimates index returns, which we term MLRSR. The unbiased MLRSR estimators are analogous to the RSR estimators but are arithmetic averages of individual asset returns. Simulations show that these estimators are robust to time-varying cross-sectional variance and that the MLRSR may be more accurate than RSR and some alternative methods. [source] Combined definition of seed transfer guidelines for ecological restoration in the French PyreneesAPPLIED VEGETATION SCIENCE, Issue 1 2010S. Malaval Abstract Question: Can genetic tools combined with phytogeography help to define local plants and how geographically close the source population should be to the restoration site? Location: Subalpine and alpine French Pyrenees. Methods: The main phytogeographic boundaries in the French Pyrenees described by different authors were studied and this geographic pattern was compared with the results of genetic analysis for the four Pyrenean plants studied (Trifolium alpinum, Festuca eskia, Festuca gautieri and Rumex scutatus), based on random amplified polymorphic DNA (RAPD) marker analysis, unweighted pair-group method with arithmetic averages (UPGMA) analysis and Mantel correlograms comparing geographic and genetic distances. Results: The genetic analysis allowed definition of two main evolutionarily significant units (ESUs) for the plants under study. Although the limit between the two zones was slightly variable according to the species considered, an eastern and a western ESU was consistently observed. This delineation was concordant with the main phytogeographic boundaries of the French Pyrenees. Conclusion: RAPD markers and associated Mantel correlograms can be useful to draw ESUs for individual species when the sampling intensity is relatively dense, and similarities were revealed between species sharing the same distribution range. This delineation allowed integration of infraspecific plant variation in the management of natural resources for revegetation in the Pyrenees. Nevertheless, caution is needed for the establishment of seed pools in order to maximize genetic diversity in each of the pools during collection and production. [source] | |||||||||||||