Home About us Contact
|
Home About us Contact | ||
|
|
||
Magnesium Chloride (magnesium + chloride)
Selected AbstractsLimits of life in MgCl2 -containing environments: chaotropicity defines the windowENVIRONMENTAL MICROBIOLOGY, Issue 3 2007John E. Hallsworth Summary The biosphere of planet Earth is delineated by physico-chemical conditions that are too harsh for, or inconsistent with, life processes and maintenance of the structure and function of biomolecules. To define the window of life on Earth (and perhaps gain insights into the limits that life could tolerate elsewhere), and hence understand some of the most unusual biological activities that operate at such extremes, it is necessary to understand the causes and cellular basis of systems failure beyond these windows. Because water plays such a central role in biomolecules and bioprocesses, its availability, properties and behaviour are among the key life-limiting parameters. Saline waters dominate the Earth, with the oceans holding 96.5% of the planet's water. Saline groundwater, inland seas or saltwater lakes hold another 1%, a quantity that exceeds the world's available freshwater. About one quarter of Earth's land mass is underlain by salt, often more than 100 m thick. Evaporite deposits contain hypersaline waters within and between their salt crystals, and even contain large subterranean salt lakes, and therefore represent significant microbial habitats. Salts have a major impact on the nature and extent of the biosphere, because solutes radically influence water's availability (water activity) and exert other activities that also affect biological systems (e.g. ionic, kosmotropic, chaotropic and those that affect cell turgor), and as a consequence can be major stressors of cellular systems. Despite the stressor effects of salts, hypersaline environments can be heavily populated with salt-tolerant or -dependent microbes, the halophiles. The most common salt in hypersaline environments is NaCl, but many evaporite deposits and brines are also rich in other salts, including MgCl2 (several hundred million tonnes of bischofite, MgCl2·6H2O, occur in one formation alone). Magnesium (Mg) is the third most abundant element dissolved in seawater and is ubiquitous in the Earth's crust, and throughout the Solar System, where it exists in association with a variety of anions. Magnesium chloride is exceptionally soluble in water, so can achieve high concentrations (> 5 M) in brines. However, while NaCl-dominated hypersaline environments are habitats for a rich variety of salt-adapted microbes, there are contradictory indications of life in MgCl2 -rich environments. In this work, we have sought to obtain new insights into how MgCl2 affects cellular systems, to assess whether MgCl2 can determine the window of life, and, if so, to derive a value for this window. We have dissected two relevant cellular stress-related activities of MgCl2 solutions, namely water activity reduction and chaotropicity, and analysed signatures of life at different concentrations of MgCl2 in a natural environment, namely the 0.05,5.05 M MgCl2 gradient of the seawater : hypersaline brine interface of Discovery Basin , a large, stable brine lake almost saturated with MgCl2, located on the Mediterranean Sea floor. We document here the exceptional chaotropicity of MgCl2, and show that this property, rather than water activity reduction, inhibits life by denaturing biological macromolecules. In vitro, a test enzyme was totally inhibited by MgCl2 at concentrations below 1 M; and culture medium with MgCl2 concentrations above 1.26 M inhibited the growth of microbes in samples taken from all parts of the Discovery interface. Although DNA and rRNA from key microbial groups (sulfate reducers and methanogens) were detected along the entire MgCl2 gradient of the seawater : Discovery brine interface, mRNA, a highly labile indicator of active microbes, was recovered only from the upper part of the chemocline at MgCl2 concentrations of less than 2.3 M. We also show that the extreme chaotropicity of MgCl2 at high concentrations not only denatures macromolecules, but also preserves the more stable ones: such indicator molecules, hitherto regarded as evidence of life, may thus be misleading signatures in chaotropic environments. Thus, the chaotropicity of MgCl2 would appear to be a window-of-life-determining parameter, and the results obtained here suggest that the upper MgCl2 concentration for life, in the absence of compensating (e.g. kosmotropic) solutes, is about 2.3 M. [source] Chemical, Microbiological, and Sensory Quality of Cod Products Salted in Different BrinesJOURNAL OF FOOD SCIENCE, Issue 1 2005Maria J. Rodrigues ABSTRACT: Studies were carried out on the effect of different brines containing high concentrations of calcium chloride (CaCl2, 0.8%w/w), magnesium chloride (MgCl2, 0.4%w/w), and potassium chloride (KCl, 50%) on the chemical (chloride and moisture contents), microbial (total viable counts, total coliforms, enterococci, and staphylococci), and sensory quality of salted cod. The brines were prepared from combinations of the Ca, Mg, and K ions and sodium chloride (NaCl) at pH 6.5 and 8.5. Additionally, 3 salts (one composed solely of NaCl, another commercial sea salt from the southern Europe and, finally, a natural salt from northern Europe) were also tested. Principal component analysis structured the chemical and microbiology data in 3 clusters: (1) an extreme cluster, formed by cod brined in the commercial sea salt, which achieved the highest microbiological counts, namely 4.1 log CFU/g on plate count agar (PCA) and 1250 coliforms/g; (2) an intermediate cluster composed of cod salted in brine containing 50% NaCl, 0.4% MgCl2, and 49.6% KCl (pH 6.5); and (3) a central cluster, including all the other treatments, which presented the lowest microbiological counts, namely 2.4 log CFU/g on PCA and 20 coliforms/g. Although the batches of the intermediate cluster presented slightly higher total viable and staphylococci counts than the central cluster, the presence of Mg and K ions improved the color of the salted product. In the assayed concentrations, CaCl2, MgCl2, and KCl can be used in the brining of cod without adversely affecting the microbiological and sensory quality of the salted cod. [source] Copolymerization of ethylene with 1-hexene over metallocene catalyst supported on complex of magnesium chloride with tetrahydrofuranJOURNAL OF POLYMER SCIENCE (IN TWO SECTIONS), Issue 10 2004Krystyna Czaja Abstract The study of ethylene/1-hexene copolymerization with the zirconocene catalyst, bis(cyclopentadienyl)zirconium dichloride (Cp2ZrCl2)/methylaluminoxane (MAO), anchored on a MgCl2(THF)2 support was carried out. The influence of 1-hexene concentration in the feed on catalyst productivity and comonomer reactivity as well as other properties was investigated. Additionally, the effect of support modification by the organoaluminum compounds [(MAO, trimethlaluminum (AlMe3), or diethylaluminum chloride (Et2AlCl)] on the behavior of the MgCl2(THF)2/Cp2ZrCl2/MAO catalyst in the copolymerization process and on the properties of the copolymers was explored. Immobilization of the Cp2ZrCl2 compound on the complex magnesium support MgCl2(THF)2 resulted in an effective system for the copolymerization of ethylene with 1-hexene. The modification of the support as well as the kind of organoaluminum compound used as a modifier influenced the activity of the examined catalyst system. Additionally, the profitable influence of immobilization of the homogeneous catalyst as well as modification of the support applied on the molecular weight and molecular weight distribution of the copolymers was established. Finally, with the successive self-nucleation/annealing procedure, the copolymers obtained over both homogeneous and heterogeneous metallocene catalysts were heterogeneous with respect to their chemical composition. © 2004 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 42: 2512,2519, 2004 [source] Grafting of functionalized silica particles with poly(acrylic acid)POLYMERS FOR ADVANCED TECHNOLOGIES, Issue 6 2006Jarkko J. Heikkinen Abstract Two different methods to graft silica particles with poly(acrylic acid) (PAA) were studied. In the first method PAA was reacted with 1,1,-carbonyldiimidazole to give functionalized PAA. The resulting activated carbonyl group reacted easily with 3-aminopropyl-functionalized silica at low temperatures. In the second method 3-glycidoxypropyl-functionalized silica particles were reacted directly with PAA by using magnesium chloride as a catalyst. Different molecular weights of PAAs were used in order to investigate the effect of molecular weight on grafting yields in both methods. The grafting yields were determined with thermogravimetric analysis (TGA). All products were also investigated with IR. The results showed that the yields of reactions performed at ambient temperature by using 1,1,-carbonyldiimidazole-functionalized PAA were the same as with a direct reaction of unfunctionalized PAA and 3-aminopropyl-functionalized silica performed at 153°C. Also in reactions between 3-glycidoxypropyl-functionalized silica and PAA the yields were satisfactory. Copyright © 2006 John Wiley & Sons, Ltd. [source] Metabolic activity variations in the sea urchins (Paracentrotus lividus) treated with magnesium and subjected to handling stress and aerial exposureAQUACULTURE RESEARCH, Issue 9 2010Soumaya Arafa Abstract This study assessed the impact of the use of magnesium chloride as a relaxant for the echinoid Paracentrotus lividus on the metabolic activity of individuals subjected to handling stress and aerial exposure. The variation in the gonad moisture content and biochemical composition was compared in sea urchins (P. lividus) treated with magnesium and untreated controls before transport and during 15 days of laboratory acclimation. Sea urchins treated with magnesium maintained higher levels of protein and carbohydrate throughout the trial in comparison with controls. However, the lipid level and fatty acid percentage remained stable during the experiment and no differences were found between treated or non-treated sea urchins . [source] Crystallization and preliminary crystallographic analysis of endonuclease VIII in its uncomplexed formACTA CRYSTALLOGRAPHICA SECTION D, Issue 8 2004Gali Golan The Escherichia coli DNA repair enzyme endonuclease VIII (EndoVIII or Nei) excises oxidized pyrimidines from damaged DNA substrates. It overlaps in substrate specificity with endonuclease III and may serve as a back-up for this enzyme in E. coli. The three-dimensional structure of Nei covalently complexed with DNA has been recently determined, revealing the critical amino-acid residues required for DNA binding and catalytic activity. Based on this information, several site-specific mutants of the enzyme have been tested for activity against various substrates. Although the crystal structure of the DNA-bound enzyme has been fully determined, the important structure of the free enzyme has not previously been analyzed. In this report, the crystallization and preliminary crystallographic characterization of DNA-free Nei are described. Four different crystal habits are reported for wild-type Nei and two of its catalytic mutants. Despite being crystallized under different conditions, all habits belong to the same crystal form, with the same space group (I222) and a similar crystallographic unit cell (average parameters a = 57.7, b = 80.2, c = 169.7,Å). Two of these crystal habits, I and IV, appear to be suitable for full crystallographic analysis. Crystal habit I was obtained by vapour diffusion using PEG 8000, glycerol and calcium acetate. Crystal habit IV was obtained by a similar method using PEG 400 and magnesium chloride. Both crystals are mechanically strong and stable in the X-ray beam once frozen under cold nitrogen gas. A full diffraction data set has recently been collected from a wild-type Nei crystal of habit I (2.6,Å resolution, 85.2% completeness, Rmerge = 9.8%). Additional diffraction data were collected from an Nei-R252A crystal of habit IV (2.05,Å resolution, 99.9% completeness, Rmerge = 6.0%) and an Nei-E2A crystal of habit IV (2.25,Å resolution, 91.7% completeness, Rmerge = 6.2%). These diffraction data were collected at 95,100 K using a synchrotron X-ray source and a CCD area detector. All three data sets are currently being used to obtain crystallographic phasing via molecular-replacement techniques. [source] Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3,-terminusACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 5 2010Hyun Koo Yeo The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3,-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8,Å resolution. The oligonucleotide was crystallized at 277,K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34,Å, , = 91.37, , = 93.21, , = 92.35°. [source] HIGH-DOSE TAURINE SUPPLEMENTATION INCREASES SERUM PARAOXONASE AND ARYLESTERASE ACTIVITIES IN EXPERIMENTAL HYPOTHYROIDISMCLINICAL AND EXPERIMENTAL PHARMACOLOGY AND PHYSIOLOGY, Issue 9 2007Melahat Dirican SUMMARY 1Hypothyroidism is accompanied by hyperlipidaemia and oxidative stress and is associated with several complications, such as atherosclerosis. Paraoxonase activity has been reported to decrease in several situations associated with atherosclerosis and oxidative stress. In the present study, the effects of different doses of taurine on serum paraoxonase and arylesterase activities, as well as on the serum lipid profile, were investigated in hypothyroid rats. 2Forty male Sprague-Dawley rats were randomly divided into five groups as follows: Group 1, rats received normal rat chow and tap water; Group 2, rats received standard rat chow + 0.05% propylthiouracil (PTU) in the drinking water; and Groups 3,5, taurine-supplemented PTU groups (standard rat chow + 0.5, 2 or 3% taurine in the drinking water, respectively, in addition to PTU). Paraoxon or phenylacetate were used as substrates to measure paraoxonase and arylesterase activity, respectively. Plasma and tissue malondialdehyde (MDA) levels, indicators of lipid peroxidation, were determined using the thiobarbituric-acid reactive substances method. Serum triglyceride, total cholesterol and high-density lipoprotein,cholesterol (following precipitation with dextran sulphate,magnesium chloride) were determined using enzymatic methods. 3Serum paraoxonase and arylesterase activities were increased and plasma and tissue MDA levels and serum triglyceride levels were reduced in a dose-dependent manner in taurine-treated hypothyroid rats. Taurine concentrations were positively correlated with enzyme activities and negatively correlated with MDA and triglyceride levels. 4Further studies are needed to investigate the role of taurine supplementation in hypothyroidism in human subjects. [source] Nitrite Toxicity to Litopenaeus vannamei in Water Containing Low Concentrations of Sea Salt or Mixed SaltsJOURNAL OF THE WORLD AQUACULTURE SOCIETY, Issue 4 2004Anthony Sowers The uptake, depuration and toxicity of environmental nitrite was characterized in Litopenaeus vannamei exposed in water containing low concentrations of artificial sea salt or mixed salts. In 2 g/L artificial sea salts, nitrite was concentrated in the hemolymph in a dose-dependent and rapid manner (steady-state in about 2 d). When exposed to nitrite in 2 g/L artificial sea salts for 4 d and then moved to a similar environment without added nitrite, complete depuration occurred within a day. Increasing salinity up to 10 g/L decreased uptake of environmental nitrite. Nitrite uptake in environments containing 2 g/L mixed salts (combination of sodium, potassium, calcium and magnesium chlorides) was similar to or lower than rates in 2 g/L artificial sea salt. Toxicity was inversely related to total dissolved salt and chloride concentrations and was highest in 2 g/L artificial sea salt (96-h medial lethal concentration = 8.4 mg/L nitrite-N). Animals that molted during the experiments did not appear to be more susceptible to nitrite than animals that did not molt. The shallow slope of the curve describing the relationship between toxicity and salinity suggests that management of nitrite toxicity in low-salinity shrimp ponds by addition of more salts may not be practical. [source] | ||||||||||||||||