Home About us Contact
|
Home About us Contact | ||
|
|
||
mRNA Translation (mrna + translation)
Selected AbstractsCellular oxygen sensing, signalling and how to survive translational arrest in hypoxiaACTA PHYSIOLOGICA, Issue 2 2009M. Fähling Abstract Hypoxia is a consequence of inadequate oxygen availability. At the cellular level, lowered oxygen concentration activates signal cascades including numerous receptors, ion channels, second messengers, as well as several protein kinases and phosphatases. This, in turn, activates trans -factors like transcription factors, RNA-binding proteins and miRNAs, mediating an alteration in gene expression control. Each cell type has its unique constellation of oxygen sensors, couplers and effectors that determine the activation and predominance of several independent hypoxia-sensitive pathways. Hence, altered gene expression patterns in hypoxia result from a complex regulatory network with multiple divergences and convergences. Although hundreds of genes are activated by transcriptional control in hypoxia, metabolic rate depression, as a consequence of reduced ATP level, causes inhibition of mRNA translation. In a multi-phase response to hypoxia, global protein synthesis is suppressed, mainly by phosphorylation of eIF2-alpha by PERK and inhibition of mTOR, causing suppression of 5,-cap-dependent mRNA translation. Growing evidence suggests that mRNAs undergo sorting at stress granules, which determines the fate of mRNA as to whether being translated, stored, or degraded. Data indicate that translation is suppressed only at ,free' polysomes, but is active at subsets of membrane-bound ribosomes. The recruitment of specific mRNAs into subcellular compartments seems to be crucial for local mRNA translation in prolonged hypoxia. Furthermore, ribosomes themselves may play a significant role in targeting mRNAs for translation. This review summarizes the multiple facets of the cellular adaptation to hypoxia observed in mammals. [source] MicroRNA expression during chick embryo developmentDEVELOPMENTAL DYNAMICS, Issue 11 2006Diana K. Darnell Abstract MicroRNAs (miRNAs) are small, abundant, noncoding RNAs that modulate protein abundance by interfering with target mRNA translation or stability. miRNAs are detected in organisms from all domains and may regulate 30% of transcripts in vertebrates. Understanding miRNA function requires a detailed determination of expression, yet this has not been reported in an amniote species. High-throughput whole mount in situ hybridization was performed on chicken embryos to map expression of 135 miRNA genes including five miRNAs that had not been previously reported in chicken. Eighty-four miRNAs were detected before day 5 of embryogenesis, and 75 miRNAs showed differential expression. Whereas few miRNAs were expressed during formation of the primary germ layers, the number of miRNAs detected increased rapidly during organogenesis. Patterns highlighted cell-type, organ or structure-specific expression, localization within germ layers and their derivatives, and expression in multiple cell and tissue types and within sub-regions of structures and tissues. A novel group of miRNAs was highly expressed in most tissues but much reduced in one or a few organs, including the heart. This study presents the first comprehensive overview of miRNA expression in an amniote organism and provides an important foundation for investigations of miRNA gene regulation and function. Developmental Dynamics 235:3156,3165, 2006. © 2006 Wiley-Liss, Inc. [source] Neuronal calcium sensor-1 gene ncs-1a is essential for semicircular canal formation in zebrafish inner earDEVELOPMENTAL NEUROBIOLOGY, Issue 3 2005Brian Blasiole Abstract We have analyzed the functional role of neuronal calcium sensor-1 (Ncs-1) in zebrafish development. We identified two orthologs of the mammalian NCS-1 gene. Full-length cDNAs encoding zebrafish Ncs-1a and Ncs-1b polypeptides were cloned and characterized. Whole-mount in situ hybridization revealed that ncs-1a mRNA was expressed beginning at early somitogenesis. As development progressed, ncs-1a mRNA was present throughout the embryo with expression detected in ventral hematopoietic mesoderm, pronephric tubules, CNS nuclei, and otic vesicle. By 4.5 days post fertilization (dpf), ncs-1a expression was detected primarily in the brain. Expression of ncs-1b mRNA was first detected at 36 hours post fertilization (hpf) and was restricted to the olfactory bulb. By 4.5 dpf, ncs-1b was expressed at low levels throughout the brain. Knockdown of ncs-1a mRNA translation with antisense morpholinos blocked formation of semicircular canals. These studies identify a novel function for ncs-1a in inner ear development and suggest that this calcium sensor plays an important role in vestibular function. © 2005 Wiley Periodicals, Inc. J Neurobiol, 2005 [source] Hypothermia treatment potentiates ERK1/2 activation after traumatic brain injuryEUROPEAN JOURNAL OF NEUROSCIENCE, Issue 4 2007Coleen M. Atkins Abstract Traumatic brain injury (TBI) results in significant hippocampal pathology and hippocampal-dependent memory loss, both of which are alleviated by hypothermia treatment. To elucidate the molecular mechanisms regulated by hypothermia after TBI, rats underwent moderate parasagittal fluid-percussion brain injury. Brain temperature was maintained at normothermic or hypothermic temperatures for 30 min prior and up to 4 h after TBI. The ipsilateral hippocampus was assayed with Western blotting. We found that hypothermia potentiated extracellular signal-regulated kinase 1/2 (ERK1/2) activation and its downstream effectors, p90 ribosomal S6 kinase (p90RSK) and the transcription factor cAMP response element-binding protein. Phosphorylation of another p90RSK substrate, Bad, also increased with hypothermia after TBI. ERK1/2 regulates mRNA translation through phosphorylation of mitogen-activated protein kinase-interacting kinase 1 (Mnk1) and the translation factor eukaryotic initiation factor 4E (eIF4E). Hypothermia also potentiated the phosphorylation of both Mnk1 and eIF4E. Augmentation of ERK1/2 activation and its downstream signalling components may be one molecular mechanism that hypothermia treatment elicits to improve functional outcome after TBI. [source] IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domainFEBS JOURNAL, Issue 24 2006Gopal P. Patel Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5, untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nm and 5.9 nm, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3, end of the ARS. Results of our analysis suggest that both protein·protein and protein·RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA. [source] The proteasome inhibitor, MG132, promotes the reprogramming of translation in C2C12 myoblasts and facilitates the association of hsp25 with the eIF4F complexFEBS JOURNAL, Issue 17 2004Joanne L. Cowan The eukaryotic translation initiation factor (eIF) 4E, is regulated by modulating both its phosphorylation and its availability to interact with the scaffold protein, eIF4G, to form the mature eIF4F complex. Here we show that treatment of C2C12 myoblasts with the proteasomal inhibitor, MG132 (N -carbobenzoxyl-Leu-Leu-leucinal), resulted in an early decrease in protein synthesis rates followed by a partial recovery, reflecting the reprogramming of translation. The early inhibition of protein synthesis was preceded by a transient increase in eIF2, phosphorylation, followed by a sustained increase in eIF4E phosphorylation. Inhibition of eIF4E phosphorylation with CGP57380 failed to prevent translational reprogramming or the moderate decrease in eIF4F complexes at later times. Prolonged incubation with MG132 resulted in the increased expression of heat shock protein (hsp)25, ,B-crystallin and hsp70, with a population of hsp25 associating with the eIF4F complex in a p38 mitogen-activated protein kinase-dependent manner. Under these conditions, eIF4GI, and to a lesser extent eIF4E, re-localized from a predominantly cytoplasmic distribution to a more perinuclear and granular staining. Although MG132 had little effect on the colocalization of eIF4E and eIF4GI, it promoted the SB203580-sensitive association of eIF4GI and hsp25, an effect not observed with ,B-crystallin. Addition of recombinant hsp25 to an in vitro translation assay resulted in stimulation of on-going translation and a moderate decrease in de novo translation, indicating that this modified eIF4F complex containing hsp25 has a role to play in recovery of mRNA translation following cellular stress. [source] Increased expression of the heterogeneous nuclear ribonucleoprotein K in pancreatic cancer and its association with the mutant p53INTERNATIONAL JOURNAL OF CANCER, Issue 2 2010Renyuan Zhou Abstract The heterogeneous nuclear ribonucleoprotein (hnRNP) K is an essential RNA and DNA binding protein involved in gene expression and signal transduction including DNA transcription, RNA splicing, RNA stability and translation. The role of hnRNP K in cancer is relatively understudied. However, several cellular functions strongly indicate that hnRNP K is involved in tumorigenesis. In this study, we investigated the altered protein expression and the subcellular distribution of the hnRNP K protein using tissue microarrays in pancreatic cancer. We showed an increased cytoplasmic hnRNP K in pancreatic cancer. This increase in hnRNP K protein occurs at the posttranscriptional level. We postulate that the cytoplasmic accumulation of hnRNP K will lead to silenced mRNA translation of tumor suppressor genes and thus contributes to pancreatic cancer development. We also demonstrated that knocking down of hnRNP K expression by siRNA inhibited pancreatic cancer cell growth and colony formation. hnRNP K was identified as a member of the p53/HDM2 pathway. Whether hnRNP K interacts with the mutant p53 is not known. Using two different pancreatic cancer cell lines, we can demonstrate that hnRNP K interacts with the mutant p53. The subcellular distribution and function of the mutant p53 and the interaction of hnRNP K/mutant p53 were affected by the Ras/MEK/ERK pathway, growth factors and the specific p53 mutations in pancreatic cancer cells. Since Kras is activated and p53 is mutated in most pancreatic cancers, these data unveiled an important new signaling pathway that linked by hnRNP K and mutant p53 in pancreatic cancer tumorigenesis. [source] drr-2 encodes an eIF4H that acts downstream of TOR in diet-restriction-induced longevity of C. elegansAGING CELL, Issue 4 2010Tsui-Ting Ching Summary Dietary restriction (DR) results in a robust increase in lifespan while maintaining the physiology of much younger animals in a wide range of species. Here, we examine the role of drr-2, a DR-responsive gene recently identified, in determining the longevity of Caenorhabditis elegans. Inhibition of drr-2 has been shown to increase longevity. However, the molecular mechanisms by which drr-2 influences longevity remain unknown. We report here that drr-2 encodes an ortholog of human eukaryotic translation initiation factor 4H (eIF4H), whose function is to mediate the initiation step of mRNA translation. The molecular function of DRR-2 is validated by the association of DRR-2 with polysomes and by the decreased rate of protein synthesis observed in drr-2 knockdown animals. Previous studies have also suggested that DR might trigger a regulated reduction in drr-2 expression to initiate its longevity response. By examining the effect of increasing drr-2 expression on DR animals, we find that drr-2 is essential for a large portion of the longevity response to DR. The nutrient-sensing target of rapamycin (TOR) pathway has been shown to mediate the longevity effects of DR in C. elegans. Results from our genetic analyses suggest that eIF4H/DRR-2 functions downstream of TOR, but in parallel to the S6K/PHA-4 pathway to mediate the lifespan effects of DR. Together, our findings reveal an important role for eIF4H/drr-2 in the TOR-mediated longevity responses to DR. [source] Hot topics in aging research: protein translation, 2009AGING CELL, Issue 6 2009Brian K. Kennedy Summary In the last few years, links between regulation of mRNA translation and aging have been firmly established in invertebrate model organisms. This year, a possible relationship between mRNA translation and aging in mammals has been established with the report that rapamycin increases lifespan in mice. Other significant findings have connected translation control with other known longevity pathways and provided fodder for mechanistic hypotheses. Here, we summarize advances in this emerging field and raise questions for future studies. [source] Restoration of Protein Synthesis in Heart and Skeletal Muscle After Withdrawal of AlcoholALCOHOLISM, Issue 4 2004Thomas C. Vary Abstract: Background: The rate of protein synthesis is diminished after chronic alcohol consumption through changes in both mRNA translation initiation and elongation. It remains unknown how long adverse effects of alcohol on protein synthesis persist after withdrawal from ethanol. Methods: We examined the effect of removal of alcohol from the diet of rats for 72 hr after chronic alcohol exposure (16 weeks) on rates of protein synthesis and potential mechanisms for controlling mRNA translation in heart, skeletal muscle, and liver. Rates of protein synthesis were measured after intravenous infusion of [3H]-l-phenylalanine. The formation of active eukaryotic initiation factor (eIF)4E·eIF4G complex, the cellular content of eukaryotic elongation factor (eEF)1A and eEF2, and the phosphorylation state of eEF2 and S6K1 were measured in each tissue. Results: Withdrawal of alcohol from the diet restored protein synthesis in heart and skeletal muscle to values obtained in pair-fed control rats not exposed to alcohol. However, the organ weight and protein content per muscle was not affected by withdrawal of alcohol from the diet. In both heart and skeletal muscle, the restoration of protein synthesis correlated with reversal of defects in the formation of active eIF4E·eIF4G complex and eEF1A content. Myocardial eEF2 content was also restored to control values after withdrawal of alcohol from the diet. In the gastrocnemius, there was a decrease in the cellular content of eEF2. The lower eIF2 content may have been counterbalanced by an increased activity of eEF2 through a reduction in the phosphorylation state of eEF2 allowing protein synthesis to proceed unimpeded. Conclusions: These studies indicate that changes in protein metabolism observed during chronic alcohol intake are reversible and do not, at this stage, represent an irreversible change in cardiac or skeletal muscle. [source] EGCG inhibits protein synthesis, lipogenesis, and cell cycle progression through activation of AMPK in p53 positive and negative human hepatoma cellsMOLECULAR NUTRITION & FOOD RESEARCH (FORMERLY NAHRUNG/FOOD), Issue 9 2009Chi-Hung Huang Abstract In the previous studies, (,)-epigallocatechin-3-gallate (EGCG) has been shown to have anticarcinogenic effects via modulation in protein expression of p53. Using p53 positive Hep G2 and p53 negative Hep 3B cells, we found that treatment of EGCG resulted in dose-dependent inhibition of cellular proliferation, which suggests that the interaction of EGCG with p53 may not fully explain its inhibitory effect on proliferation. Caloric restriction (CR) reduces the incidence and progression of spontaneous and induced tumors in laboratory rodents. EGCG has multiple beneficial activities similar to those associated with CR. One key enzyme thought to be activated during CR is AMP-activated kinase (AMPK), a sensor of cellular energy levels. Here, we showed that EGCG activated AMPK in both p53 positive and negative human hepatoma cells. The activation of AMPK suppressed downstream substrates, such as mammalian target of rapamycin (mTOR) and eukaryotic initiation factor 4E-binding protein-1 (4E-BP1) and a general decrease in mRNA translation. Moreover, EGCG activated AMPK decreases the activity and/or expression of lipogenic enzymes, such as fatty acid synthase (FASN) and acetyl-CoA carboxylase (ACC). Interestingly, the decision between apoptosis and growth arrest following AMPK activation is greatly influenced by p53 status. In p53 positive Hep G2 cells, EGCG blocked the progression of cell cycle at G1 phase by inducing p53 expression and further up-regulating p21 expression. However, EGCG inducted apoptosis in p53 negative Hep 3B cells. Based on these results, we have demonstrated that EGCG has a potential to be a chemoprevention and anti-lipogenesis agent for human hepatoma cells. [source] The proximal promoter governs germ cell-specific expression of the mouse glutathione transferase mGstm5 geneMOLECULAR REPRODUCTION & DEVELOPMENT, Issue 4 2009Hironari Dehari To explain the tissue-selective expression patterns of a distinct subclass of glutathione S -transferase (GST), transgenic mice expressing EGFP under control of a 2 kb promoter sequence in the 5,-flanking region of the mGstm5 gene were produced. The intent of the study was to establish whether the promoter itself or whether posttranscriptional mechanisms, particularly at the levels of mRNA translation and stability or protein targeting, based on unique properties of mGSTM5, determine the restricted expression pattern. Indeed, the transgene expression was limited to testis as the reporter was not detected in somatic tissues such as brain, kidney or liver, indicating that the mGstm5 proximal promoter is sufficient to target testis-specific expression of the gene. EGFP expression was also more restricted vis-a-vis the natural mGstm5 gene and exclusively found in germ but not in somatic cells. Real-time quantitative PCR (qPCR) data were consistent with alternate transcription start sites in which the promoter region of the natural mGstm5 gene in somatic cells is part of exon 1 of the germ cell transcript. Thus, the primary transcription start site for mGstm5 is upstream of a TATA box in testis and downstream of this motif in somatic cells. The 5, flanking sequence of the mGstm5 gene imparts germ cell-specific transcription. Mol. Reprod. Dev. 76: 379,388, 2009. © 2008 Wiley-Liss, Inc. [source] The mTOR target 4E-BP1 contributes to differential protein expression during normoxia and hypoxia through changes in mRNA translation efficiencyPROTEINS: STRUCTURE, FUNCTION AND BIOINFORMATICS, Issue 5 2008Michaël G. Magagnin Abstract Hypoxia causes a rapid and sustained inhibition in mRNA translation that is characterized by both a transient phosphorylation of eukaryotic initiation factor 2-alpha (eIF2,) and by inhibition of the mRNA cap binding protein eIF4E via activation of two distinct inhibitory proteins, the mammalian target of rapamycin (mTOR) target 4E-BP1 and the eIF4E transporter 4E-T. Although the importance of eIF2, phosphorylation during hypoxia has been clearly demonstrated, there is little information on the potential relevance of eIF4E regulation. We generated HeLa cells stably expressing a short hairpin interfering RNA (shRNA) against 4E-BP1 and found that despite efficient knockdown, no significant changes occurred in the overall inhibition of mRNA translation during hypoxia. However, using a proteomics approach we identified seven proteins that were exclusively expressed in the 4E-BP1 knockdown cells during both normoxic and hypoxic conditions. Further investigation of the transcriptional and translational regulation of these genes by quantitative RT-PCR indicated that the loss of 4E-BP1 causes a significant increase in the rate of protein synthesis of S100 calcium-binding protein A4 (S100A4) and transgelin 2. These 4E-BP1 regulated proteins have previously been associated with tumor cell motility, invasion and metastasis and may thus contribute to an adverse tumor phenotype. [source] Resistance exercise-induced increases in putative anabolic hormones do not enhance muscle protein synthesis or intracellular signalling in young menTHE JOURNAL OF PHYSIOLOGY, Issue 21 2009Daniel W. D. West We aimed to determine whether exercise-induced elevations in systemic concentration of testosterone, growth hormone (GH) and insulin-like growth factor-1 (IGF-1) enhanced post-exercise myofibrillar protein synthesis (MPS) and phosphorylation of signalling proteins important in regulating mRNA translation. Eight young men (20 ± 1.1 years, BMI = 26 ± 3.5 kg m,2) completed two exercise protocols designed to maintain basal hormone concentrations (low hormone, LH) or elicit increases in endogenous hormones (high hormone, HH). In the LH protocol, participants performed a bout of unilateral resistance exercise with the elbow flexors. The HH protocol consisted of the same elbow flexor exercise with the contralateral arm followed immediately by high-volume leg resistance exercise. Participants consumed 25 g of protein after arm exercise to maximize MPS. Muscle biopsies and blood samples were taken as appropriate. There were no changes in serum testosterone, GH or IGF-1 after the LH protocol, whereas there were marked elevations after HH (testosterone, P < 0.001; GH, P < 0.001; IGF-1, P < 0.05). Exercise stimulated a rise in MPS in the biceps brachii (rest = 0.040 ± 0.007, LH = 0.071 ± 0.008, HH = 0.064 ± 0.014% h,1; P < 0.05) with no effect of elevated hormones (P= 0.72). Phosphorylation of the 70 kDa S6 protein kinase (p70S6K) also increased post-exercise (P < 0.05) with no differences between conditions. We conclude that the transient increases in endogenous purportedly anabolic hormones do not enhance fed-state anabolic signalling or MPS following resistance exercise. Local mechanisms are likely to be of predominant importance for the post-exercise increase in MPS. [source] Exercise rapidly increases eukaryotic elongation factor 2 phosphorylation in skeletal muscle of menTHE JOURNAL OF PHYSIOLOGY, Issue 1 2005Adam J. Rose Protein synthesis in skeletal muscle is known to decrease during contractions but the underlying regulatory mechanisms are unknown. Here, the effect of exercise on skeletal muscle eukaryotic elongation factor 2 (eEF2) phosphorylation, a key component in protein translation machinery, was examined. Eight healthy men exercised on a cycle ergometer at a workload eliciting ,67% peak pulmonary oxygen consumption with skeletal muscle biopsies taken from the vastus lateralis muscle at rest as well as after 1, 10, 30, 60 and 90 min of exercise. In response to exercise, there was a rapid (i.e. < 1 min) 5- to 7-fold increase in eEF2 phosphorylation at Thr56 that was sustained for 90 min of continuous exercise. The in vitro activity of skeletal muscle eEF2 kinase was not altered by exercise indicating that the increased activity of eEF2 kinase to eEF2 is not mediated by covalent mechanisms. In support of this, the increase in AMPK activity was temporally unrelated to eEF2 phosphorylation. However, skeletal muscle eEF2 kinase was potently activated by Ca2+,calmodulin in vitro, suggesting that the higher eEF2 phosphorylation in working skeletal muscle is mediated by allosteric activation of eEF2 kinase by Ca2+ signalling via calmodulin. Given that eEF2 phosphorylation inhibits eEF2 activity and mRNA translation, these findings suggest that the inhibition of protein synthesis in contracting skeletal muscle is due to the Ca2+ -induced stimulation of eEF2 kinase. [source] MicroRNA expression profiles of porcine skeletal muscleANIMAL GENETICS, Issue 5 2010B. Zhou Summary MicroRNAs (miRNAs) are endogenous non-coding RNAs of ,22 nucleotides in length that play important roles in multiple biological processes by degrading targeted mRNAs or repressing mRNA translation. To evaluate the roles of miRNA in porcine skeletal muscle, miRNA expression profiles were investigated using longissimus muscle tissue from pigs at embryonic day 90 (E90) and postpartum day 120 (PD120). First, we used previously known miRNA sequences from humans and mice to perform blast searches against the porcine expressed sequence tag (EST) database; 98 new miRNA candidates were identified according to a range of filtering criteria. These miRNA candidates and 73 known miRNAs (miRBase 13.0) from pigs were chosen for porcine miRNA microarray analysis. A total of 16 newly identified miRNAs and 31 previously known miRNAs were detected in porcine skeletal muscle tissues. During later foetal development at E90, miR-1826, miR-26a, miR-199b and let-7 were highly expressed, whilst miR-1a, miR-133a, miR-26a and miR-1826 showed highest abundance during the fast growing stage at PD120. Using the 47 miRNAs detected by the microarray assay, we performed further investigations using the publicly available porcine mRNA database from NCBI and computed potential target hits using the software rnahybrid. This study identified 16 new miRNA candidates, computed potential target hits for 18 miRNA families and determined the miRNA expression profiles in porcine skeletal muscle tissues at different developmental stages. These results provide a valuable resource for investigators interested in post-transcriptional gene regulation in pigs and related animals. [source] Computational identification of new porcine microRNAs and their targetsANIMAL SCIENCE JOURNAL, Issue 3 2010Bo ZHOU ABSTRACT MicroRNAs (miRNAs) represent a newly identified class of non-protein-coding ,22 nt small RNAs which play important roles in multiple biological processes by degrading targeted mRNAs or repressing mRNA translation. Here we present an expressed sequence tag (EST)-based combined approach for the detection of novel porcine miRNAs. This was initiated by using previously known miRNA sequences from Homo sapiens (human) and Mus musculus (mouse) to blast the databases of Sus scrofa (pig) EST. A total of 65 new miRNAs were detected following a range of filtering criteria. Using these new potential miRNA sequences, we further obtained the publicly available porcine mRNA database from NCBI and detected 48 586 potential target hits using a software RNA hybrid. So far, compared to human and mouse, fewer miRNAs (only 54 miRNAs) were identified in Sus scrofa species. These 65 new miRNAs and their targets in pig have been run through miRHelper to yield data that may help us better understand the possible role of miRNAs in regulating the growth and development of pigs. These findings suggest that EST analysis is a good alternative strategy for identifying new miRNA candidates, their targets and other genes. [source] Nonsense-mediated decay: paving the road for genome diversificationBIOESSAYS, Issue 10 2008Francisco Sánchez-Sánchez The expression of protein-encoding genes is a complex process culminating in the production of mature mRNA and its translation by the ribosomes. The production of a mature mRNA involves an intricate series of processing steps. The majority of eukaryotic protein-encoding genes contain intron sequences that disrupt the protein-encoding frame, and hence have to be removed from immature mRNA prior to translation into protein. The mechanism involved in the selection of correct splice sites is incompletely understood. A considerable body of evidence suggests that the splicing machinery has suboptimal efficiency and fidelity leading to substantial processing inaccuracy. Here we discuss a recently published article1 that extends observations that cells rely on nonsense- mediated mRNA decay (NMD) to compensate for such suboptimal processing accuracy. Intriguingly these authors provide evidence for a strong selective pressure in favour of premature termination of mRNA translation in the event of intron retention. The analysis presented implies a positive role of NMD in transcript diversification through alternative splicing and suggest that this ancient surveillance mechanism may have co-evolved with intron acquisition born from the need for quality control of splicing patterns. BioEssays 30:926,928, 2008. © 2008 Wiley Periodicals, Inc. [source] Cell line-specific control of recombinant monoclonal antibody production by CHO cells,BIOTECHNOLOGY & BIOENGINEERING, Issue 6 2010Peter M. O'Callaghan Abstract In this study we compare the cellular control of recombinant human IgG4 monoclonal antibody (Mab) synthesis in different CHO cell lines. Based on comprehensive empirical analyses of mRNA and polypeptide synthetic intermediates we constructed cell line-specific mathematical models of recombinant Mab manufacture in seven GS-CHO cell lines varying in specific production rate (qMab) over 350-fold. This comparative analysis revealed that control of qMab involved both genetic construct and cell line-specific factors. With respect to the former, all cell lines exhibited excess production of light chain (LC) mRNA and polypeptide relative to heavy chain (HC) mediated by more rapid LC transcription and enhanced LC mRNA stability. Downstream of this, cell lines differed markedly in their relative rates of recombinant mRNA translation, Mab assembly and secretion although HC mRNA abundance and the rate of HC translation generally exerted most control over qMab,the latter being directly proportional to qMab. This study shows that (i) cell lines capable of high qMab exceed a threshold functional competency in all synthetic processes, (ii) the majority of cells in parental and transfected cell populations are functionally limited and (iii) cell engineering strategies to increase Mab production should be cell line specific. Biotechnol. Bioeng. 2010;106: 938,951. © 2010 Wiley Periodicals, Inc. [source] | |||||||||||||||||||||||||