Important Disease (important + disease)

Distribution by Scientific Domains


Selected Abstracts


A region on equine chromosome 13 is linked to recurrent airway obstruction in horses

EQUINE VETERINARY JOURNAL, Issue 3 2007
U. JOST
Summary Reasons for study: Equine recurrent airway obstruction (RAO) is probably dependent on a complex interaction of genetic and environmental factors and shares many characteristic features with human asthma. Interleukin 4 receptor , chain (IL4RA) is a candidate gene because of its role in the development of human asthma, confirmation of this association is therefore required. Methods: The equine BAC clone containing the IL4RA gene was localised to ECA13q13 by the FISH method. Microsatellite markers in this region were investigated for possible association and linkage with RAO in 2 large Warmblood halfsib families. Based on a history of clinical signs (coughing, nasal discharge, abnormal breathing and poor performance), horses were classified in a horse owner assessed respiratory signs index (HOARSI 1,4: from healthy, mild, moderate to severe signs). Four microsatellite markers (AHT133, LEX041, VHL47, ASB037) were analysed in the offspring of Sire 1 (48 unaffected HOARSI 1 vs. 59 affected HOARSI 2,4) and Sire 2 (35 HOARSI 1 vs. 50 HOARSI 2,4), age ,7 years. Results: For both sires haplotypes could be established in the order AHT133-LEX047-VHL47-ASB37. The distances in this order were estimated to be 2.9, 0.9 and 2.3 centiMorgans, respectively. Haplotype association with mild to severe clinical signs of chronic lower airway disease (HOARSI 2,4) was significant in the offspring of Sire 1 (P = 0.026) but not significant for the offspring of Sire 2 (P = 0.32). Linkage analysis showed the ECA13q13 region containing IL4RA to be linked to equine chronic lower airway disease in one family (P<0.01), but not in the second family. Conclusions: This supports a genetic background for equine RAO and indicates that IL4RA is a candidate gene with possible locus heterogeneity for this disease. Potential relevance: Identification of major genes for RAO may provide a basis for breeding and individual prevention for this important disease. [source]


RAPID SPECIATION FOLLOWING RECENT HOST SHIFTS IN THE PLANT PATHOGENIC FUNGUS RHYNCHOSPORIUM

EVOLUTION, Issue 6 2008
Pascal L. Zaffarano
Agriculture played a significant role in increasing the number of pathogen species and in expanding their geographic range during the last 10,000 years. We tested the hypothesis that a fungal pathogen of cereals and grasses emerged at the time of domestication of cereals in the Fertile Crescent and subsequently speciated after adaptation to its hosts. Rhynchosporium secalis, originally described from rye, causes an important disease on barley called scald, although it also infects other species of Hordeum and Agropyron. Phylogenetic analyses based on four DNA sequence loci identified three host-associated lineages that were confirmed by cross-pathogenicity tests. Bayesian analyses of divergence time suggested that the three lineages emerged between ,1200 to 3600 years before present (B.P.) with a 95% highest posterior density ranging from 100 to 12,000 years B.P. depending on the implemented clock models. The coalescent inference of demographic history revealed a very recent population expansion for all three pathogens. We propose that Rhynchosporium on barley, rye, and Agropyron host species represent three cryptic pathogen species that underwent independent evolution and ecological divergence by host-specialization. We postulate that the recent emergence of these pathogens followed host shifts. The subsequent population expansions followed the expansion of the cultivated host populations and accompanying expansion of the weedy Agropyron spp. found in fields of cultivated cereals. Hence, agriculture played a major role in the emergence of the scald diseases, the adaptation of the pathogens to new hosts and their worldwide dissemination. [source]


Subcellular localization of proteins labeled with GFP in Xanthomonas citri ssp. citri: targeting the division septum

FEMS MICROBIOLOGY LETTERS, Issue 1 2010
Paula M.M. Martins
Abstract Xanthomonas citri ssp. citri (Xac) is the causal agent of citrus canker, an economically important disease that affects citrus worldwide. To initiate the characterization of essential biological processes of Xac, we constructed integrative plasmids for the ectopic expression of green fluorescent protein (GFP)-labeled proteins within this bacterium. Here, we show that the disruption of the ,-amylase gene (amy), the site of plasmid integration into the bacterial chromosome, does not alter its pathogenesis while abolishing completely the ability of Xac to degrade starch. Furthermore, our GFP expression system was used to characterize ORF XAC3408, a hypothetical protein encoded by Xac that shares significant homology to the FtsZ-stabilizing factor ZapA from Bacillus subtilis (ZapABsu). GFP-XAC3408 expressed in Xac exhibited a septal localization pattern typical of GFP-ZapABsu, which indicates that XAC3408 is the Xac orthologue of the cell division protein ZapABsu. The results demonstrate the potential of GFP labeling for protein functional characterizations in Xac, and, in addition, the Xac mutant strain labeled at the septum constitutes a biological model for the exploration of antibacterial compounds able to inhibit cell division in this plant pathogen. [source]


URP-based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

JOURNAL OF PHYTOPATHOLOGY, Issue 4 2010
Rashmi Aggarwal
Abstract Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs') are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5,GTGTGCGATCAGTTGCTGGG3,) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. [source]


Identification and Molecular Characterization of ,Candidatus Phytoplasma mali' Isolates in North-western Italy

JOURNAL OF PHYTOPATHOLOGY, Issue 2 2010
Paola Casati
Abstract Apple proliferation (AP) is an important disease and is prevalent in several European countries. The causal agent of AP is ,Candidatus Phytoplasma mali' (,Ca. Phytoplasma mali'). In this work, isolates of ,Ca. Phytoplasma mali' were detected and characterized through polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analyses of 16S rRNA gene and non-ribosomal DNA fragment. The presence of three AP subtypes (AT-1, AT-2 and AP-15) was identified in 31 symptomatic apple trees and two samples each constituted by a pool of five insects, collected in north-western Italy, where AT-1 is a dominant subtype. Subsequent nucleotide sequence analysis of the PCR-amplified 1.8 kb (P1/P7) fragment, containing the 16S rDNA, the 16S,23S intergenic ribosomal region and the 5,-end of the 23S rDNA, revealed the presence of at least two phytoplasmal genetic lineages within the AT-1 subtype, designed AT-1a and AT-1b. Moreover, in silico single nucleotide polymorphism (SNP) analysis based on 16S rDNA sequence can differentiate AT-1 subtype from AT-2 and AP-15 subtypes. Our data showed a high degree of genetic diversity among ,Ca. Phytoplasma mali' population in north-western Italy and underlined the possible use of the 16S rDNA analysis for the identification and the geographical origin assignation of isolates of AP phytoplasma. Molecular markers on 16S rDNA, here identified, could be useful for studying the epidemiology of AP disease. [source]


Variation in Aggressiveness of Stagonospora nodorum Isolates in North Dakota

JOURNAL OF PHYTOPATHOLOGY, Issue 3 2008
S. Ali
Abstract Stagonospora nodorum blotch (SNB), caused by Stagonospora nodorum, is an important disease in the northern Great Plains of the United States and in other wheat-producing regions in the world. SNB can be managed by different strategies including the use of resistant cultivars. Genetic variation in the pathogen populations is one of the important factors in the development of durable resistant cultivars. Our main objective was to determine variation in aggressiveness/virulence in the 40 isolates of S. nodorum collected from various locations in North Dakota. To achieve this goal, we tested the isolates on two susceptible wheat cultivars (cvs ,ND495' and ,Alsen') and two resistant wheat cultivars (cvs ,Erik' and ,Salamouni') , two-leaf-stage seedlings under controlled conditions. Aggressiveness of each isolate was characterized by the two epidemiological parameters: percent necrotic leaf area (% NLA) and lesion type (LT) 8 days post-inoculation. The isolates differed significantly (P , 0.05) for % NLA and LT, and were grouped into three aggressiveness groups (AG): low, medium and highly aggressive. Four isolates (S50, S57, S66 and S89) induced 18,26% NLA and were included into the low aggressive group (AG 1). Three isolates (S15, S39 and S89) induced 57,59% NLA and were considered highly aggressive (AG 3). Thirty-three isolates were medium aggressive (AG 2). No relationship between AG and mating types was observed. There were significant (P , 0.05) differences in % NLA and LT among wheat cultivars. Significant wheat cultivars by isolates interaction was also demonstrated, suggesting evidence for the existence of host specificity in this system. Overall, our results indicate that S. nodorum isolates prevalent in North Dakota varied greatly in their aggressiveness and that AG 3 isolates can be utilized in breeding wheat for resistance to SNB. [source]


The AraC/XylS regulator TxtR modulates thaxtomin biosynthesis and virulence in Streptomyces scabies

MOLECULAR MICROBIOLOGY, Issue 3 2007
Madhumita V. Joshi
Summary Streptomyces scabies is the best studied of those streptomycetes that cause an economically important disease known as potato scab. The phytotoxin thaxtomin is made exclusively by these pathogens and is required for virulence. Here we describe regulation of thaxtomin biosynthesis by TxtR, a member of the AraC/XylS family of transcriptional regulators. The txtR gene is imbedded in the thaxtomin biosynthetic pathway and is located on a conserved pathogenicity island in S. scabies, S. turgidiscabies and S. acidiscabies. Thaxtomin biosynthesis was abolished and virulence was almost eliminated in the txtR deletion mutant of S. scabies 87.22. Accumulation of thaxtomin biosynthetic gene (txtA, txtB, txtC, nos) transcripts was reduced compared with the wild-type S. scabies 87.22. NOS-dependent nitric oxide production by S. scabies was also reduced in the mutant. The TxtR protein bound cellobiose, an inducer of thaxtomin production, and transcription of txtR and thaxtomin biosynthetic genes was upregulated in response to cellobiose. TxtR is the first example of an AraC/XylS family protein regulated by cellobiose. Together, these data suggest that cellobiose, the smallest oligomer of cellulose, may signal the availability of expanding plant tissue, which is the site of action of thaxtomin. [source]


Development of molecular markers linked to the wheat powdery mildew resistance gene Pm4b and marker validation for molecular breeding

PLANT BREEDING, Issue 2 2008
Y. J. Yi
Abstract Powdery mildew, caused by Blumeria graminis (DC.) E.O. Speer f. sp. tritici, is an important disease in wheat (Triticum aestivum L.). Bulk segregant analysis (BSA) was employed to identify SRAP (sequence-related amplified polymorphism), sequence tagged site (STS) and simple sequence repeat (SSR) markers linked to the Pm4b gene, which confers good resistance to powdery mildew in wheat. Out of 240 SRAP primer combinations tested, primer combinations Me8/Em7 and Me12/Em7 yielded 220-bp and 205-bp band, respectively, each of them associated with Pm4b. STS- 241 also linked to Pm4b with a genetic distance of 4.9 cM. Among the eight SSR markers located on wheat chromosome 2AL, Xgwm382 was found to be polymorphic and linked to Pm4b with a genetic distance of 11.8 cM. Further analysis was carried out using the four markers to investigate marker validation for marker-assisted selection (MAS). The results showed that a combination of the linked markers STS,241, Me8/Em7,220 and Xgwm382 could be used for marker-assisted selection of the resistance gene Pm4b in wheat breeding programmes. [source]


Development of molecular markers for crown rot resistance in wheat: mapping of QTLs for seedling resistance in a ,2-49' × ,Janz' population

PLANT BREEDING, Issue 6 2005
B. C. Y. Collard
Abstract Crown rot, caused by Fusarium pseudograminearum, is an important disease of wheat in Australia and elsewhere. In order to identify molecular markers associated with partial seedling resistance to this disease, bulked segregant analysis and quantitative trait loci (QTL) mapping approaches were undertaken using a population of 145 doubled haploid lines constructed from ,2-49' (partially resistant) × ,Janz' (susceptible) parents. Phenotypic data indicated that the trait is quantitatively inherited. The largest QTLs were located on chromosomes 1D and 1A, and explained 21% and 9% of the phenotypic variance, respectively. Using the best markers associated with five QTLs identified by composite interval mapping, the combined effect of the QTLs explained 40.6% of the phenotypic variance. All resistance alleles were inherited from ,2-49' with the exception of a QTL on 2B, which was inherited from ,Janz'. A minor QTL on 4B was loosely linked (19.8 cM) to the Rht1 locus in repulsion. None of the QTLs identified in this study were located in the same region as resistance QTLs identified in other populations segregating for Fusarium head blight, caused by Fusarium graminearum. [source]


Epidemiology and management of Leptosphaeria maculans (phoma stem canker) on oilseed rape in Australia, Canada and Europe

PLANT PATHOLOGY, Issue 1 2001
J. S. West
Phoma stem canker (blackleg), caused by Leptosphaeria maculans, is an important disease on oilseed rape (canola, rapeseed, Brassica napus, Brassica juncea, Brassica rapa) causing seedling death, lodging or early senescence in Australia, Canada and Europe, but not in China. The two forms of L. maculans (A group and B group) that occur on oilseed rape are now considered to be separate species. The epidemiology and severity of phoma stem canker differs between continents due to differences in the pathogen population structure, oilseed rape species and cultivars grown, climate and agricultural practices. Epidemics are most severe in Australia, where only the A group occurs, and can be damaging in Canada and western Europe, where both A and B groups occur, although their proportions vary within regions and throughout the year. Epidemics are slight in China, where the A group has not been found. Dry climates (Australia, western Canada) lengthen the persistence of infected debris and may synchronize the release of airborne ascospores (after rain) with seedling emergence. L. maculans spreads from cotyledon and leaf infections down petioles to reach the stem, with infections on cotyledons and leaves early in the season producing the most damaging stem cankers at the stem base (crown). Development of both crown cankers and phoma stem lesions higher up stems is most rapid in regions with high temperatures from flowering to harvest, such as Australia and Canada. Breeding for resistance (genetic, disease escape or tolerance), stubble management, crop rotation and fungicide seed treatments are important strategies for control of phoma stem canker in all areas. Fungicide spray treatments are justified only in regions such as western Europe where high yields are obtained, and accurate forecasts of epidemic severity are needed to optimize their use. [source]


Efficacy of triazoles and strobilurins in controlling black spot disease of roses caused by Diplocarpon rosae

ANNALS OF APPLIED BIOLOGY, Issue 2 2009
E.W. Gachomo
Abstract Black spot disease is an important disease of roses with worldwide occurrence. It is caused by Diplocarpon rosae, an ascomycetous fungus and its control relies on fungicides. The effects of strobilurins and triazoles on D. rosae development within the host and on disease symptoms have not been well studied. Strobilurins completely inhibited germination of conidia when applied protectively 1 week before inoculation or on the same day with the inoculum. They were, however, not effective in eradicating the disease when applied after the fungus was established in the host. Triazoles reduced the germination rate of the conidia when applied protectively and they inhibited disease symptom development when applied after the fungus was established in the host but before symptom expression. Application of triazoles after symptom development suppressed further development of the disease, but in the case of treatment with myclobutanil yellowing and defoliation still occurred. Post-infection application of triazoles led to the apparent breakdown of subcuticular mycelia, intercellular mycelia, and hyphae in the epidermal cells, while the effects of strobilurins were limited to the subcuticular mycelia. Triazoles were more effective than strobilurins because they are more systemic. [source]


Serologic screening for celiac disease in children: a comparison between established assays and tests with deamidated gliadin-derived peptides plus conjugates for both IgA and IgG antibodies

APMIS, Issue 11 2009
ANNA-KARIN ÅBERG
Selection of patients for diagnostic biopsy concerning celiac disease (CD) is mainly guided by the results with serological screening tests like anti-tissue-transglutaminase (tTG), anti-endomysium (EmA) and anti-gliadin (AGA) IgA. New tests using deamidated gliadin-derived peptides (DGP) including both IgA and IgG antibodies have been developed, to cover the IgA-deficient sera. In addition, a combined IgA and IgG DGP test, with or without human erythrocyte-derived tTG, offers possible advantages. In order to explore the screening accuracy of the new combination tests sera from 167 children below 3 years of age were assayed. Biopsy had been taken in connection with serology in 32 of these children, 24 with histopathological CD. The results with the DGP and the combined test were congruent with the IgA antibody tests for tTG, EmA and AGA, all identifying 21 of 24 of the CD cases. Two of the CD patients were AGA-IgA positive only (2/24), while 2 of 24 sera were AGA,IgA negative but positive in all the other tests. These results raises the question whether the modifications of the gliadin antigen not only decrease false positivity but also give more false-negative results, a major drawback for a screening test for an important disease. Further studies have to be undertaken to explore this. Our results also stress that serologic screening of CD in children cannot be based on one test only. [source]


Review: Alternatives to synthetic fungicides for Botrytis cinerea management in vineyards

AUSTRALIAN JOURNAL OF GRAPE AND WINE RESEARCH, Issue 1 2010
M.A. JACOMETTI
Abstract Botrytis cinerea (Pers.: Fr), the causal agent of botrytis bunch rot, is an important disease of grapevines worldwide, with canopy management and the prophylactic use of fungicides being the most common control methods. The latter has resulted in fungicide resistance and is increasingly raising concerns regarding residues in wine and effects on human and environmental health. Research-led alternatives to this practice are beginning to emerge, including a range of biotic and abiotic treatments that induce vine resistance to B. cinerea and inundative applications of biological control agents such as Trichoderma, Bacillus, Ulocladium and Streptomyces species. Also, habitat manipulation techniques that aim to improve the effectiveness of naturally occurring biological control are being developed using mulches brought into the vineyard, as well as mulched cover crops. These can accelerate decomposition of botrytis mycelium and sclerotia on the vineyard floor in winter. The challenges of these different techniques and the prospects for habitat manipulation for this fungal disease are discussed. Extensive tables on synthetic fungicides, biofungicides, essential oils and plant extracts effective against B. cinerea are included. [source]


Spontaneous coronary artery dissection

CLINICAL CARDIOLOGY, Issue 7 2004
Francis Q. Almeda M.D.
Abstract Spontaneous coronary artery dissection (SCAD) is an unusual cause of acute myocardial ischemia with complex pathophysiology. This paper reviews the major diagnostic and therapeutic issues of this rare but important disease. The diagnosis of SCAD should be strongly considered in any patient who presents with symptoms suggestive of acute myocardial ischemia, particularly in young subjects without traditional risk factors for coronary artery disease (especially in young women during the peripartum period or in association with oral contraceptive use). Urgent coronary angiography is indicated to establish the diagnosis and to determine the appropriate therapeutic approach. The decision to pursue medical management, percutaneous coronary intervention, or surgical revascularization is based primarily on the clinical presentation, extent of dissection, and amount of ischemic myocardium at risk. [source]


Lipids and skin barrier function , a clinical perspective

CONTACT DERMATITIS, Issue 5 2008
Jakob Mutanu Jungersted
The stratum corneum (SC) protects us from dehydration and external dangers. Much is known about the morphology of the SC and penetration of drugs through it, but the data are mainly derived from in vitro and animal experiments. In contrast, only a few studies have the human SC lipids as their focus and in particular, the role of barrier function in the pathogenesis of skin disease and its subsequent treatment protocols. The 3 major lipids in the SC of importance are ceramides, free fatty acids, and cholesterol. Human studies comparing levels of the major SC lipids in patients with atopic dermatitis and healthy controls have suggested a possible role for ceramide 1 and to some extent ceramide 3 in the pathogenesis of the disease. Therapies used in diseases involving barrier disruption have been sparely investigated from a lipid perspective. It has been suggested that ultraviolet light as a treatment increases the amount of all 3 major SC lipids, while topical glucocorticoids may lead to a decrease. Such effects may influence the clinical outcome of treatment in diseases with impaired barrier function. We have, therefore, conducted a review of the literature on SC lipids from a clinical perspective. It may be concluded that the number of human studies is very limited, and in the perspective of how important diseases of impaired barrier function are in dermatology, further research is needed. [source]


Pasteurella multocida pathogenesis: 125 years after Pasteur

FEMS MICROBIOLOGY LETTERS, Issue 1 2006
Marina Harper
Abstract Pasteurella multocida was first shown to be the causative agent of fowl cholera by Louis Pasteur in 1881. Since then, this Gram-negative bacterium has been identified as the causative agent of many other economically important diseases in a wide range of hosts. The mechanisms by which these bacteria can invade the mucosa, evade innate immunity and cause systemic disease are slowly being elucidated. Key virulence factors identified to date include capsule and lipopolysaccharide. The capsule is clearly involved in bacterial avoidance of phagocytosis and resistance to complement, while complete lipopolysaccharide is critical for bacterial survival in the host. A number of other virulence factors have been identified by both directed and random mutagenesis, including Pasteurella multocida toxin (PMT), putative surface adhesins and iron acquisition proteins. However, it is likely that many key virulence factors are yet to be identified, including those required for initial attachment and invasion of host cells and for persistence in a relatively nutrient poor and hostile environment. [source]


Molecular mechanisms underlying inflammatory lung diseases in the elderly: Development of a novel therapeutic strategy for acute lung injury and pulmonary fibrosis,

GERIATRICS & GERONTOLOGY INTERNATIONAL, Issue 3 2005
Takahide Nagase
In the elderly, inflammatory lung diseases, including acute lung injury and pulmonary fibrosis, are significant in terms of both mortality and difficulty in management. Acute respiratory distress syndrome (ARDS) is an acute lung injury and the mortality rate for ARDS ranges from 40 to 70% despite intensive care. Idiopathic pulmonary fibrosis (IPF) is a progressive and fatal disorder of the lung parenchyma. No useful drugs are currently available to treat IPF. However, molecular mechanisms underlying these lung diseases are little understood and the development of a novel therapeutic strategy is urgently needed. Platelet-activating factor (PAF) and metabolites of arachidonic acid, i.e. eicosanoids, are lipid mediators that have various biological effects. A key enzyme for the production of these inflammatory mediators, including eicosanoids and PAF, is phospholipase A2. In particular, cytosolic PLA2 (cPLA2) is especially important. The purpose of this article is to report novel findings regarding the role of PAF and cPLA2 in lung inflammatory diseases, especially, acute lung injury and pulmonary fibrosis. To address this question, we used mutant mice, i.e. PAFR transgenic mice, PAFR gene-disrupted mice and cPLA2 gene-disrupted mice. We have shown that PAF and eicosanoids, downstream mediators of cPLA2, may be involved in the pathogenesis of ARDS and IPF, which are important diseases in the elderly. Although there exist extreme differences in clinical features between ARDS and IPF, both diseases are fatal disorders for which no useful drugs are currently available. On the basis of recent reports using mutant mice, cPLA2 might be a potential target to intervene in the development of pulmonary fibrosis and acute lung injury in the elderly. [source]


Wheat Resistance to Spot Blotch Potentiated by Silicon

JOURNAL OF PHYTOPATHOLOGY, Issue 5 2010
Gisele Pereira Domiciano
Abstract Spot blotch, caused by the fungus Bipolaris sorokiniana, is one of the most important diseases on wheat. The effects of silicon (Si) on this wheat disease were studied. Plants of wheat cultivars BR-18 and BRS-208 were grown in plastic pots containing Si-deficient soil amended with either calcium silicate (+Si) or calcium carbonate (,Si). The content of Si in leaf tissue was significantly increased by 90.5% for the +Si treatment. There was no significant difference between Si treatments for calcium content, so variations in Si accounted for differences in the level of resistance to spot blotch. The incubation period was significantly increased by 40% for the +Si treatment. The area under spot blotch progress curve, number of lesions per cm2 of leaf area, and real disease severity significantly decreased by 62, 36 and 43.5% in +Si treatment. There was no significant effect of Si on lesion size. The role played by total soluble phenolics in the increased resistance to spot blotch of plants from both cultivars supplied with Si was not clear. Plants from cultivar BR-18 supplied with Si showed the highest values for concentration of lignin-thioglycolic acid derivatives during the most advanced stages of fungus infection. Chitinase activity was high at the most advanced stages of fungus infection on leaves from both cultivars supplied with Si and may have had an effect on fungus growth based on the reduction of the components of resistance evaluated. Peroxidase activity was found to be high only at 96 h after inoculation of both cultivars supplied with Si. Polyphenoloxidase activity had no apparent effect on resistance regardless of Si treatments. Results revealed that supplying Si to wheat plants can increase resistance against spot blotch. [source]


Identification of Three Strains of a Virus Associated with Cassava Plants Affected by Frogskin Disease

JOURNAL OF PHYTOPATHOLOGY, Issue 11-12 2008
L. A. Calvert
Abstract Cassava Frogskin Disease (CFSD) can cause severe damage to cassava roots and is one of the most important diseases of cassava in Latin America. The principal objective of this study was to identify the causal agent of CFSD. Electron microscopy, viral purifications, double-stranded RNA (dsRNA) analysis, cloning, sequencing, rtPCR and hybridizations were carried out to characterize and associate a novel virus with the disease. Virus-like particles of 70 and 45 nm in diameter were found in affected cassava plants and partially purified preparations respectively. Nine species of dsRNA were associated with this disease and cDNA clones to six genomic segments were synthesized from the purified dsRNAs. The putative proteins predicted from the sequence of the cassava virus cDNA clones have similarity with the P1, P2, P3, P4, P5 and P10 proteins of Rice ragged stunt virus (RRSV). Phylogenic analysis confirmed that this virus is a member of the family Reoviridae and is most closed related to RRSV. Hybridization analyses of dsRNA identified S1, S2, S3, S4, S5 and S10 genomic segments in the CFSD-affected plants, but not in healthy controls. Additionally, 26 isolates were compared using a portion of the putative polymerase gene. The virus was detected in all 26 isolates, and they were classified into three distinct races. The association of this virus with CFSD was strengthened by the detection of this virus in diseased plants collected from different locations throughout Colombia. [source]


Cultural Characterization and Conidial Dimorphism in Colletotrichum sublineolum

JOURNAL OF PHYTOPATHOLOGY, Issue 7-8 2003
E. A. Souza-Paccola
Abstract Anthracnose, caused by Colletotrichum sublineolum, is one of the most important diseases of sorghum in Brazil. This fungus showed conidial dimorphism when cultivated on solid or in liquid media. In solid media only falcate conidia were produced, whereas in liquid media the conidia were of variable size, but mostly oval. Wild strains, differentiated by their , and , esterase electrophoretic profiles, were assessed. The effect of different culture media on the production of both conidial types was evaluated. Unlike that of oval conidia, the production of falcate conidia was light-dependent. Some strains failed to produce falcate conidia in solid media, but all produced oval conidia in all the liquid media. The falcate conidia were uninucleate, but oval conidia contained one to three nuclei, although most were uninucleate. Both types of conidia induced symptoms in inoculable sorghum plants under controlled conditions. Both oval and falcate conidia produced mutants after exposure to UV light, and hyphal anastomoses occurred in crosses between mutant conidia carriers of complementary markers. The production of these oval conidia in C. sublineolum is an alternative to pathogenicity tests and genetic studies, especially for strains that sporulate poorly in solid culture media. [source]


Unravelling the genetic diversity of the three main viruses involved in Sweet Potato Virus Disease (SPVD), and its practical implications

MOLECULAR PLANT PATHOLOGY, Issue 2 2005
FRED TAIRO
SUMMARY Sweetpotato (Ipomoea batatas) is a widely grown food crop, in which the most important diseases are caused by viruses. Genetic variability of three widely distributed sweetpotato viruses was analysed using data from 46 isolates of Sweet potato feathery mottle virus (SPFMV), 16 isolates of Sweet potato mild mottle virus (SPMMV) and 25 isolates of Sweet potato chlorotic stunt virus (SPCSV), of which 19, seven and six isolates, respectively, are newly characterized. Division of SPFMV into four genetic groups (strains) according to phylogenetic analysis of coat protein (CP) encoding sequences revealed that strain EA contained the East African isolates of SPFMV but none from elsewhere. In contrast, strain RC contained ten isolates from Australia, Africa, Asia and North America. Strain O contained six heterogeneous isolates from Africa, Asia and South America. The seven strain C isolates from Australia, Africa, Asia, and North and South America formed a group that was genetically distant from the other SPFMV strains. SPMMV isolates showed a high level of variability with no discrete strain groupings. SPCSV isolates from East Africa were phylogenetically distant to SPCSV isolates from elsewhere. Only from East Africa were adequate data available for different isolates of the three viruses to estimate the genetic variability of their local populations. The implications of the current sequence information and the need for more such information from most sweetpotato-growing regions of the world are discussed in relation to virus diagnostics and breeding for virus resistance. [source]


Alternaria spp.: from general saprophyte to specific parasite

MOLECULAR PLANT PATHOLOGY, Issue 4 2003
Bart P. H. J. Thomma
SUMMARY Alternaria species are mainly saprophytic fungi. However, some species have acquired pathogenic capacities collectively causing disease over a broad host range. This review summarizes the knowledge on pathogenic strategies employed by the fungus to plunder the host. Furthermore, strategies employed by potential host plants in order to ward off an attack are discussed. Taxonomy:Alternaria spp. kingdom Fungi, subkingdom Eumycotera, phylum Fungi Imperfecti (a non-phylogenetic or artificial phylum of fungi without known sexual stages whose members may or may not be related; taxonomy does not reflect relationships), form class Hypomycetes, Form order Moniliales, form family Dematiaceae, genus Alternaria. Some species of Alternaria are the asexual anamorph of the ascomycete Pleospora while others are speculated to be anamorphs of Leptosphaeria. Host Range: Most Alternaria species are common saprophytes that derive energy as a result of cellulytic activity and are found in a variety of habitats as ubiquitous agents of decay. Some species are plant pathogens that cause a range of economically important diseases like stem cancer, leaf blight or leaf spot on a large variety of crops. Latent infections can occur and result in post-harvest diseases or damping-off in case of infected seed. Useful Website: [source]


Associations between fungal and abiotic leaf spotting and the presence of mlo alleles in barley

PLANT PATHOLOGY, Issue 6 2007
J. C. Makepeace
The hypothesis that the increased use of the powdery mildew-resistance gene mlo has caused the increase in spotting diseases of barley over the past 20 years was tested in field trials. Near-isogenic lines with alleles of the Mlo gene for susceptibility or resistance to mildew in two parental backgrounds were trialled at four sites in Scotland and two in Ireland that were prone to spotting diseases, over 3 consecutive years. Mildew was controlled by sprays with quinoxyfen. Disease levels were low in the trials, the two most important diseases being scald caused by Rhynchosporium secalis and ramularia leaf spot caused by Ramularia collo-cygni. There were high levels of abiotic spotting. Lines with mutant mlo alleles consistently developed less Rh. secalis and Ra. collo-cygni, but more abiotic spots. This study indicates that the mlo mildew-resistance gene has not alone been responsible for the rise in spotting diseases over the past 20 years. Possible reasons for the rise are discussed, including the interaction of the mlo gene with the environment. [source]