Home About us Contact | |||
Genetic Similarity (genetic + similarity)
Kinds of Genetic Similarity Selected AbstractsPotential selection in native grass populations by exotic invasionMOLECULAR ECOLOGY, Issue 8 2006BRIAN A. MEALOR Abstract Ecological impacts of invasive plant species are well documented, but the genetic response of native species to invasive dominance has been often overlooked. Invasive plants can drastically alter site conditions where they reach dominance, potentially exerting novel selective pressures on persistent native plant populations. Do native plant populations in old exotic invasions show evidence of selection when compared to conspecific populations in adjacent, noninvaded areas? We employ amplified fragment length polymorphism (AFLP) analysis to screen a large number of loci from two native grass species (Hesperostipa comata (Trin. & Rupr.) Barkworth and Sporobolus airoides Torr.) that occur in old infestations of the invasive forb Acroptilon repens. We then compare observed locus by locus FST values with distributions of FST estimated from simulation models under expectation of neutrality. We also compare the proportion of loci possibly linked to selection and those not linked to selection which exhibit parallel trends in divergence between two community types (invaded, noninvaded). Few loci (H. comata, 2.6%; S. airoides, 8.7%) in the two native grasses may be linked to genes under the influence of selection. Also, loci linked to selection showed a greater portion of parallel trends in divergence than neutral loci. Genetic similarities between community types were less than genetic similarity within community types suggesting differentiation in response to community alteration. These results indicate that a small portion of scored AFLP loci may be linked to genes undergoing selection tied to community dominance by an invasive species. We propose that native plants in communities dominated by exotic invasives may be undergoing natural selection. [source] Genetic similarity among Eurasian subspecies of boreal owls Aegolius funereusJOURNAL OF AVIAN BIOLOGY, Issue 3 2005Marni E. Koopman Boreal owls Aegolius funereus (referred to as Tengmalm's owls in Europe) breed in boreal forests throughout the Holarctic region and in high-elevation subalpine forests further south. They are currently classified as seven subspecies; six found throughout Eurasia, and one in North America. The geographic distribution of boreal owls in North America and Eurasia is similar, as are their patterns of dispersal and irruption. Because a recent genetic study of boreal owls in North America found very little genetic differentiation among widely disparate locations, we expected that boreal owls in Eurasia similarly would have very little genetic differentiation. Using seven microsatellite markers, we analyzed genetic samples from 275 boreal owls in North America, 36 in Norway, and five in eastern Russia. We found no detectable genetic differentiation between Norwegian and Russian owls, but notable differentiation between North American and Eurasian owls. Low intra-continental genetic differentiation likely results from high rates of long-distance dispersal among subpopulations of boreal owls. In light of these results, we recommend further genetic sampling of boreal owls throughout Eurasia in order to determine whether six separate subspecies here are warranted. [source] Genetic similarity of polyploids: a new version of the computer program POPDIST (version 1.2.0) considers intraspecific genetic differentiationMOLECULAR ECOLOGY RESOURCES, Issue 5 2009JÜRGEN TOMIUK Abstract For evolutionary studies of polyploid species estimates of the genetic identity between species with different degrees of ploidy are particularly required because gene counting in samples of polyploid individuals often cannot be done, e.g., in triploids the phenotype AB can be genotypically either ABB or AAB. We recently suggested a genetic distance measure that is based on phenotype counting and made available the computer program POPDIST. The program provides maximum-likelihood estimates of the genetic identities and distances between polyploid populations, but this approach is not informative for populations within species that only differ in their allele frequencies. We now close this gap by applying the frequencies of shared ,bands' in both populations to Nei's identity measure. Our simulation study demonstrates the close correlation between the band-sharing identity and the genetic identity calculated on the basis of gene frequencies for any degree of ploidy. The new extended version of POPDIST (version 1.2.0) provides the option of choosing either the maximum-likelihood estimator or the band-sharing measure. [source] Individual Odour Similarity and Discrimination in the Coruro (Spalacopus cyanus, Octodontidae)ETHOLOGY, Issue 6 2006Petra Hagemeyer Previous studies of subterranean, fossorial and above-ground rodents have demonstrated that similarities in individual odours covary with genetic similarities thus supporting the theory of odour-genes covariance (i.e. the closer the individuals are genetically, the greater the similarities between their odours). We used the habituation-generalization paradigm, where the subject is exposed to the same odour stimulus in three consecutive habituation trials followed by two test trials in which the odour from two other individuals are presented successively. Using this test design, we showed that the socially living coruros (Spalacopus cyanus) discriminate individuals on the basis of their ano-genital odours and also respond to odour similarities between individuals. Male and female subjects treated ano-genital odours of two same-sex family members and also the odours of two sibling strangers as different to each other. At the same time, they treated the odours of siblings as similar compared with the odour of an unrelated individual. No gender differences were detected. Our results contrast with those from other rodent species that did not spontaneously discriminate between individual odours of siblings from a different family than their own. The polygyneous lifestyle may provide the selective background for that difference. Additional research will be necessary to explore this hypothesis and to rule out differences due to dietary preferences and due to the type of paradigm chosen for the tests. [source] RECENT ECOLOGICAL DIVERGENCE DESPITE MIGRATION IN SOCKEYE SALMON (ONCORHYNCHUS NERKA)EVOLUTION, Issue 6 2010Scott A. Pavey Ecological divergence may result when populations experience different selection regimes, but there is considerable discussion about the role of migration at the beginning stages of divergence before reproductive isolating mechanisms have evolved. However, detection of past migration is difficult in current populations and tools to differentiate genetic similarities due to migration versus recent common ancestry are only recently available. Using past volcanic eruption times as a framework, we combine morphological analyses of traits important to reproduction with a coalescent-based genetic analysis of two proximate sockeye salmon (Oncorhynchus nerka) populations. We find that this is the most recent (,500 years, 100 generations) natural ecological divergence recorded in a fish species, and report that this divergence is occurring despite migration. Although studies of fish divergence following the retreat of glaciers (10,000,15,000 years ago) have contributed extensively to our understanding of speciation, the Aniakchak system of sockeye salmon provides a rare example of the initial stages of ecological divergence following natural colonization. Our results show that even in the face of continued migration, populations may diverge in the absence of a physical barrier. [source] Spatial analysis of taxonomic and genetic patterns and their potential for understanding evolutionary historiesJOURNAL OF BIOGEOGRAPHY, Issue 11 2004Sophia A. Bickford Abstract Aim, The aim of this research is to develop and investigate methods for the spatial analysis of diversity based on genetic and taxonomic units of difference. We use monophyletic groups of species to assess the potential for these diversity indices to elucidate the geographical components of macro-scaled evolutionary processes. Location, The range occupied by Pultenaea species in temperate and sub-tropical eastern Australia, extending from western South Australia (133° E,32° S) to Tasmania (146° E,43° S) to coastal central Queensland (148° E,20° S). Methods, We applied a series of both spatially explicit and spatially implicit analyses to explore the nature of diversity patterns in the genus Pultenaea, Fabaceae. We first analysed the eastern species as a whole and then the phylogenetic groups within them. We delineated patterns of endemism and biotic (taxon) regions that have been traditionally circumscribed in biogeographical studies of taxa. Centres of endemism were calculated using corrected weighted endemism at a range of spatial scales. Biotic regions were defined by comparing the similarity of species assemblages of grid cells using the Jaccard index and clustering similar cells using hierarchical clustering. On the basis that genetically coherent areas were likely to be more evolutionary informative than species patterns, genetic indices of similarity and difference were derived. A matrix of similarity distances between taxa was generated based on the number of shared informative characters of two sections of trnL-F and ndhF chloroplast nuclear regions. To identify genetically similar areas, we clustered cells using the mean genetic similarities of the species contained within each pair of cells. Measures of the mean genetic similarity of species in areas were delineated using a geographically local multi-scalar approach. Resultant patterns of genetic diversity are interpreted in relation to theories of the evolutionary relationships between species and species groups. Results, Centres of Pultenaea endemism were defined, those of clades 1 congruent with the spatially separated centres of clades 2 and 3. The taxonomic classification analysis defined cells with shared groups of species, which in some cases clustered when plotted in geographic space, defining biotic regions. In some instances the distribution of biotic regions was congruent with centres of endemism, however larger scale groupings were also apparent. In clade 1 one set of species was replaced by another along the extent of the range, with some connectivity between some geographically disjunct regions due to the presence of widespread species. In the combined analysis of clade 2 and 3 species the major biotic (taxonomic) groups with geographic coherence were defined by species in the respective clades, representing the geographic separation of these clades. However distinctive biotic regions within these main groupings of clades 2 and 3 were also apparent. Clustering cells using the mean genetic similarities of the species contained within each pair of cells indicated that some of the taxonomically defined biotic boundaries were the result of changes in composition of closely related species. This was most apparent in clades 1 and 2 where most cells were highly genetically similar. In clade 3 genetically distinct groups remained and were in part defined by sister taxa with disjunct distributions. Gradients in mean genetic similarity became more apparent from small to larger scales of analysis. At larger scales of analysis, regions of different levels of genetic diversity were delineated. Regions with highest diversity levels (lowest level of similarity) often represented regions where the ranges of phylogenetically distinctive species intergraded. Main conclusions, The combined analysis of diversity, phylogeny and geography has potential to reveal macro-scaled evolutionary patterns from which evolutionary processes may be inferred. The spatial genetic diversity indices developed in this study contribute new methods for identifying coherent evolutionary units in the landscape, which overcome some of the limitations of using taxonomic data, and from which the role of geography in evolutionary processes can be tested. We also conclude that a multiple-index approach to diversity pattern analysis is useful, especially where patterns may be the result of a long history of different environmental changes and related evolutionary events. The analysis contributes to the knowledge of large-scale diversity patterns of Pultenaea which has relevance for the assessment of the conservation status of the genus. [source] Oncogenic KRAS provides a uniquely powerful and variable oncogenic contribution among RAS family members in the colonic epitheliumJOURNAL OF CELLULAR PHYSIOLOGY, Issue 3 2007Jeffrey W. Keller Activating mutations of the RAS family of small GTPases are among the most common genetic events in human tumorigenesis. Constitutive activation of the three canonical family members, KRAS, NRAS, and HRAS segregate strongly by tissue type. Of these, KRAS mutations predominate in human tumors, including those arising from the colon and lung. We sought to compare the oncogenic contributions of different RAS isoforms in a comparable genetic setting and to explore downstream molecular changes that may explain the apparent differential oncogenic effects of the various RAS family members. We utilized colorectal cancer cell lines characterized by oncogenic KRAS in parallel with isogenically derived lines in which the mutant allele has been disrupted. We additionally attempted to reconstitute the isogenic derivatives with oncogenic forms of other RAS family members and analyze them in parallel. Pairwise analysis of HCT 116 and DLD-1 cell lines as well as their isogenic derivatives reveals distinct K-RASG13D signatures despite the genetic similarities of these cell lines. In DLD-1, for example, oncogenic K-RAS enhances the motility of these cells by downregulation of Rap1 activity, yet is not associated with increased ERK1/2 phosphorylation. In HCT 116, however, ERK1/2 phosphorylation is elevated relative to the isogenic derivative, but Rap1 activity is unchanged. K-RAS is uniquely oncogenic in the colonic epithelium, though the molecular aspects of its oncogenic contribution are not necessarily conserved across cell lines. We therefore conclude that the oncogenic contribution of K-RAS is a function of its multifaceted functionality and is highly context-dependent. J. Cell. Physiol. 210: 740,749, 2007. © 2006 Wiley-Liss, Inc. [source] Assessment of Genetic Variation Within Indian Mustard (Brassica juncea) Germplasm Using Random Amplified Polymorphic DNA MarkersJOURNAL OF INTEGRATIVE PLANT BIOLOGY, Issue 4 2008Muhammad Ayub Khan Abstract Genetic diversity among 45 Indian mustard (Brassica juncea L.) genotypes comprising 37 germplasm collections, five advance breeding lines and three improved cultivars was investigated at the DNA level using the random amplified polymorphic DNA (RAPD) technique. Fifteen primers used generated a total of 92 RAPD fragments, of which 81 (88%) were polymorphic. Of these, 13 were unique to accession ,Pak85559'. Each primer produced four to nine amplified products with an average of 6.13 bands per primer. Based on pairwise comparisons of RAPD amplification products, Nei and Li's similarity coefficients were calculated to evaluate the relationships among the accessions. Pairwise similarity indices were higher among the oilseed accessions and cultivars showing narrow ranges of 0.77,0.99. An unweighted pair-group method with arithmetic averages cluster analysis based on these genetic similarities placed most of the collections and oilseed cultivars close to each other, showing a low level of polymorphism between the accessions used. However, the clusters formed by oilseed collections and cultivars were comparatively distinct from that of advanced breeding lines. Genetically, all of the accessions were classified into a few major groups and a number of individual accessions. Advanced breeding lines were relatively divergent from the rest of the accessions and formed independent clusters. Clustering of the accessions did not show any pattern of association between the RAPD markers and the collection sites. A low level of genetic variability of oilseed mustard was attributed to the selection for similar traits and horticultural uses. Perhaps close parentage of these accessions further contributed towards their little diversity. The study demonstrated that RAPD is a simple and fast technique to compare the genetic relationship and pattern of variation among the gene pool of this crop. [source] Regulated trafficking of neurotransmitter transporters: common notes but different melodiesJOURNAL OF NEUROCHEMISTRY, Issue 1 2002Michael B. Robinson Abstract The activity of biogenic amine and amino acid neurotransmitters is limited by presynaptic and astrocytic Na+ -dependent transport systems. Their functional importance is underscored by the observation that these transporters are the targets of broad classes of psychotherapeutic agents, including antidepressants and stimulants. Early studies suggested that the activity of these transporters can be fine tuned by a number of different signaling pathways. In the past five years, several groups have provided compelling evidence that changing the cell surface availability of these transporters contributes to this fine tuning. This regulated trafficking can result in rapid (within minutes) increases or decreases in the plasma membrane expression of these transporters and is independent of transcriptional or translational control mechanisms. Many of the same signaling molecules, including protein kinase C (PKC), tyrosine kinase, phosphatidylinositol 3-kinase (P13-K), and protein phosphatase, regulate the transporters for different neurotransmitters. In addition to these classical receptor activated pathways, transporter substrates also regulate activity and cell surface expression of these transporters. In fact, some of the transporters form complexes with signaling molecules. Given the functional and genetic similarities of these transporters, it is not surprising that the same signaling molecules regulate their trafficking, but except for the molecules, the actual effects on individual transporters are remarkably different. It,is as if the same musical notes have been rearranged into several different melodies. [source] Epidemiology of meningococcal disease in AustraliaJOURNAL OF PAEDIATRICS AND CHILD HEALTH, Issue 2001J Jelfs Abstract: A review of the epidemiology of meningococcal disease (MD) in Australia was undertaken, with particular emphasis on the 1990s, when national strain differentiation data became available. The data included a review of clinical and laboratory notification data and published reports on clusters and outbreaks. There have been considerable changes in the patterns of MD in the 1990s. In some cases, these changes can be related to the dominance of a particular phenotype. In the early 1990s, widely scattered urban and rural clusters were associated with the phenotype C:2b:P1.2 and strains were closely genetically related. Larger urban clusters and increased numbers of cases in adolescents and young adults were most obvious in New South Wales in the mid-1990s and were associated with a phenotype C:2a:P1.5. This ET-15 clone of the ET-37 complex caused similar patterns of MD to those seen in other countries as part of the global spread of the clone. In contrast, the B:4:P1.4 phenotype, with close genetic similarities to New Zealand strains, did not cause the hyperendemic disease seen in New Zealand this decade. The epidemiology of MD will continue to exhibit considerable variation due, at least in part, to the genetic flexibility of meningococci. Information about strain variation expands our understanding of changing patterns of disease. [source] Prevalence and resistance patterns of extended-spectrum and AmpC ,-lactamase in Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, and Salmonella serovar Stanley in a Korean tertiary hospitalAPMIS, Issue 10 2010SOON DEOK PARK Park SD, Uh Y, Lee G, Lim K, Kim JB, Jeong SH. Prevalence and resistance patterns of extended-spectrum and AmpC ,-lactamase in Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, and Salmonella serovar Stanley in a Korean tertiary hospital. APMIS 2010; 118: 801,8. A total of 100 clinical isolates of Escherichia coli (n = 35), Klebsiella pneumoniae (n = 63), Proteus mirabilis (n = 1), and Salmonella serovar Stanley (n = 1), showing resistance to cefoxitin, or returning positive in extended-spectrum ,-lactamase (ESBL) by Clinical and Laboratory Standards Institute (CLSI) ESBL confirmatory method, were studied. The isolates were examined by the boronic acid (BA) disk test, polymerase chain reaction, and pulsed-field gel electrophoresis (PFGE) to investigate genetic similarities. The concurrence rates for ESBLs by the CLSI and the BA disk test were 97% for E. coli and 96.7% for K. pneumoniae. A total of 41 isolates showing cefoxitin resistance yielded all positive by the BA disk test. All the 33 K. pneumoniae isolates, which showed positive by the BA disk test, were carrying AmpC genes. The TEM and CTX-M types were predominant in E. coli and the SHV and the CIT and/or DHA types were predominant in K. pneumoniae. PFGE analysis showed almost 75% of genetic similarities among K. pneumoniae isolates producing ESBLs and/or AmpC ,-lactamases (AmpCs) as each K. pneumoniae carried variable genes and showed variable antibiotic patterns. Clearly, the BA disk test was a useful method for the detection of ESBLs and AmpCs. In particular, cefoxitin resistance and BA-positive trait of K. pneumoniae do reflect the presence of AmpC genes in the organism. [source] Gastrointestinal Bacterial Transmission among Humans, Mountain Gorillas, and Livestock in Bwindi Impenetrable National Park, UgandaCONSERVATION BIOLOGY, Issue 6 2008INNOCENT B. RWEGO ecología de enfermedades; Escherichia coli; primates; salud del ecosistema; zoonosis Abstract:,Habitat overlap can increase the risks of anthroponotic and zoonotic pathogen transmission between humans, livestock, and wild apes. We collected Escherichia coli bacteria from humans, livestock, and mountain gorillas (Gorilla gorilla beringei) in Bwindi Impenetrable National Park, Uganda, from May to August 2005 to examine whether habitat overlap influences rates and patterns of pathogen transmission between humans and apes and whether livestock might facilitate transmission. We genotyped 496 E. coli isolates with repetitive extragenic palindromic polymerase chain reaction fingerprinting and measured susceptibility to 11 antibiotics with the disc-diffusion method. We conducted population genetic analyses to examine genetic differences among populations of bacteria from different hosts and locations. Gorilla populations that overlapped in their use of habitat at high rates with people and livestock harbored E. coli that were genetically similar to E. coli from those people and livestock, whereas E. coli from gorillas that did not overlap in their use of habitats with people and livestock were more distantly related to human or livestock bacteria. Thirty-five percent of isolates from humans, 27% of isolates from livestock, and 17% of isolates from gorillas were clinically resistant to at least one antibiotic used by local people, and the proportion of individual gorillas harboring resistant isolates declined across populations in proportion to decreasing degrees of habitat overlap with humans. These patterns of genetic similarity and antibiotic resistance among E. coli from populations of apes, humans, and livestock indicate that habitat overlap between species affects the dynamics of gastrointestinal bacterial transmission, perhaps through domestic animal intermediates and the physical environment. Limiting such transmission would benefit human and domestic animal health and ape conservation. Resumen:,El traslape de hábitats puede incrementar los riesgos de transmisión de patógenos antroponótica y zoonótica entre humanos, ganado y simios silvestres. Recolectamos bacterias Escherichia coli de humanos, ganado y gorilas de montaña (Gorilla gorilla beringei) en el Parque Nacional Bwindi Impenetrable, Uganda, de mayo a agosto 2005 para examinar sí el traslape de hábitat influye en las tasas y patrones de transmisión de patógenos entre humanos y simios y sí el ganado facilita esa transmisión. Determinamos el genotipo de 496 aislados de E. coli con marcaje de reacción en cadena de polimerasa palindrómica extragénica (rep-PCR) y medimos la susceptibilidad a 11 antibióticos con el método de difusión de disco. Realizamos análisis de genética poblacional para examinar las diferencias genéticas entre poblaciones de bacterias de huéspedes y localidades diferentes. Las poblaciones de gorilas con alto grado de traslape en el uso de hábitat con humanos y ganado presentaron E. coli genéticamente similar a E. coli de humanos y ganado, mientras que E. coli de gorilas sin traslape en el uso hábitat con humanos y ganado tuvo relación lejana con las bacterias de humanos y ganado. Treinta y cinco porciento de los aislados de humanos, 27% de los aislados de ganado y 17% de los aislados de gorilas fueron clínicamente resistentes a por lo menos un antibiótico utilizado por habitantes locales, y la proporción de gorilas individuales con presencia de aislados resistentes declinó en las poblaciones proporcionalmente con la disminución en el grado de traslape con humanos. Estos de patrones de similitud genética y resistencia a antibióticos entre E. coli de poblaciones de simios, humanos y ganado indican que el traslape de hábitat entre especies afecta la dinámica de transmisión de bacterias gastrointestinales, probablemente a través de animales domésticos intermediarios y el ambiente físico. La limitación de esa transmisión beneficiaría a la salud de humanos y animales domésticos y a la conservación de simios. [source] Genetic Probes of Three Theories of Maternal Adjustment: II.FAMILY PROCESS, Issue 3 2001Environmental Influences, Genetic This is the first report of the Twin Mom Study, an investigation of three hypotheses concerning influences on maternal adjustment. These hypotheses concern the role of the marital and parent-child relationships in mediating genetic influences on maternal adjustment and on the importance of the mothers' marital partners as a specifiable source of influences on their adjustment not shared with their sisters. The study's sample of 150 monozygotic (MZ) twins and 176 dizygotic (DZ) twins was drawn randomly from the Swedish Twin Registry and is, with some small exceptions, likely to be representative of women in the Swedish population. The sample included the marital partners of these twins and their adolescent children. Self-report and coded videotapes were a source of information about family process. Results reported in this first report focus on comparability of American and Swedish samples on scales measuring psychiatric symptoms, and on an analysis of genetic and environmental influences on nine measures of mothers' adjustment. Results suggest comparability between the US and Sweden. Genetic influences were found for all measures of adjustment, particularly in the psychological manifestations of anxiety and for smoking. The pattern of findings also underscored the importance of influences unique to each sibling within the twin pair, thus focusing attention on the potential role of marital partners in maternal adjustment. Results also suggested that experiences shared by the twin sisters, experiences unrelated to their genetic similarity, may influence their fearfulness and alcohol consumption. Our model did not include these influences and thus must be amended. [source] Molecular epidemiology of Yersinia enterocolitica infectionsFEMS IMMUNOLOGY & MEDICAL MICROBIOLOGY, Issue 3 2006Maria Fredriksson-Ahomaa Abstract Yersinia enterocolitica is an important food-borne pathogen that can cause yersiniosis in humans and animals. The epidemiology of Y. enterocolitica infections is complex and remains poorly understood. Most cases of yersiniosis occur sporadically without an apparent source. The main sources of human infection are assumed to be pork and pork products, as pigs are a major reservoir of pathogenic Y. enterocolitica. However, no clear evidence shows that such a transmission route exists. Using PCR, the detection rate of pathogenic Y. enterocolitica in raw pork products is high, which reinforces the assumption that these products are a transmission link between pigs and humans. Several different DNA-based methods have been used to characterize Y. enterocolitica strains. However, the high genetic similarity between strains and the predominating genotypes within the bio- and serotype have limited the benefit of these methods in epidemiological studies. Similar DNA patterns have been obtained among human and pig strains of pathogenic Y. enterocolitica, corroborating the view that pigs are an important source of human yersiniosis. Indistinguishable genotypes have also been found between human strains and dog, cat, sheep and wild rodent strains, indicating that these animals are other possible infection sources for humans. [source] Evaluation of DNA polymorphisms amplified by arbitrary primers (RAPD) as genetically associated elements to differentiate virulent and non-virulent Paracoccidioides brasiliensis isolatesFEMS IMMUNOLOGY & MEDICAL MICROBIOLOGY, Issue 3 2002Teresa R Motta Abstract Randomly amplified polymorphic DNA (RAPD) analysis of 35 Paracoccidioides brasiliensis isolates was carried out to evaluate the correlation of RAPD profiles with the virulence degree or the type of the clinical manifestations of human paracoccidioidomycosis. The dendrogram presented two main groups sharing 64% genetic similarity. Group A included two isolates from patients with chronic paracoccidioidomycosis; group B comprised the following isolates showing 65% similarity: two non-virulent, six attenuated, five virulent, eight from patients with chronic paracoccidioidomycosis and two from patients with acute paracoccidioidomycosis. The virulent Pb18 isolate and six attenuated or non-virulent samples derived from it were genetically indistinguishable (100% of similarity). Thus, in our study, RAPD patterns could not discriminate among 35 P. brasiliensis isolates according to their differences either in the degree of virulence or in the type of the clinical manifestation of this fungal infection. [source] The mechanism of emergenesisGENES, BRAIN AND BEHAVIOR, Issue 4 2006D. T. Lykken Since each individual produced by the sexual process contains a unique set of genes, very exceptional combinations of genes are unlikely to appear twice even within the same family. E. O. Wilson (1978) The intraclass correlations of monozygotic twins who were separated in infancy and reared apart (MZA twins) provide estimates of trait heritability, and the Minnesota Study of Twins Reared Apart [MISTRA: Bouchard et al. (1990), The sources of human psychological differences: the Minnesota study of twins reared apart, Science 250, 223,228] has demonstrated that MZA pairs are as similar in most respects as MZ pairs reared together. Some polygenic traits,e.g. stature, IQ, harm avoidance, negative emotionality, interest in sports,are polygenic-additive, so pairs of relatives resemble one another on the given trait in proportion to their genetic similarity. But the existence and the intensity of other important psychological traits seem to be emergent properties of gene configurations (or configurations of independent and partially genetic traits) that interact multiplicatively rather than additively. Monozygotic (MZ) twins may be strongly correlated on such emergenic traits, while the similarity of dizygotic (DZ) twins, sibs or parent,offspring pairs may be much less than half that of MZ pairs. Some emergenic traits, although strongly genetic, do not appear to run in families. MISTRA has provided at least two examples of traits for which MZA twins are strongly correlated, and DZA pairs correlate near zero, while DZ pairs reared together (DZTs) are about half as similar as MZTs. These findings suggest that even more traits may be emergenic than those already identified. Studies of adoptees reared together (who are perhaps more common than twins reared apart) may help to identify traits that are emergenic, but that also are influenced by a common rearing environment. [source] Reduced genetic variation in Norwegian Peregrine Falcons Falco peregrinus indicated by minisatellite DNA fingerprintingIBIS, Issue 1 2002Jan T. Lifjeld The Scandinavian Peregrine Falcon Falco peregrinus population went through a severe population bottleneck during the second half of the twentieth century, and was almost extinct during the 1970s. This event may have reduced the amount of genetic variation in the population. With this background, a comparative study, using multilocus, minisatellite DNA fingerprinting, was carried out on broods of the Peregrine Falcon, the Merlin Falco columbarius and the Eurasian Hobby Falco subbuteo from south-east Norway. Band-sharing analysis of DNA fingerprints was used to test whether broods of Peregrine Falcons showed a greater between-nest similarity in their fingerprint profiles than did broods of the two congeneric species breeding in the same region, which have not undergone any recent population bottlenecks. The results show that broods of Peregrine Falcons were significantly more similar to each other genetically than were broods of either Merlins or Eurasian Hobbies. Furthermore, there was a positive correlation between the similarity in minisatellite DNA and the similarity in a set of 11 microsatellite loci analysed for a subset of the Peregrine Falcon samples. The correlation supports the assumption that minisatellite fingerprints provide a reliable indicator of overall genetic similarity, i.e. relatedness, between breeding pairs in the population. Hence we can conclude that broods of Peregrine Falcons were genetically more related to each other than were broods of the other two species. The high similarity in minisatellite DNA between broods indicates a loss of genetic variation in the Peregrine Falcon population caused by the bottleneck, but this explanation can only be verified through a comparative genetic study of individuals sampled before and after the bottleneck event. [source] Sub-population structure of common fish species in the Elbe River estimated from DNA analysisJOURNAL OF APPLIED ICHTHYOLOGY, Issue 5 2003C. Wolter Summary The aim of this study was to analyse the genetic structure of populations for seven common cyprinid fish species within a 120-km-long stretch of the lowland Elbe River, northern Germany. The results are needed for habitat modelling to estimate the proportion that environmentally based variance has of the total variances of home range, species distribution, habitat use and fish assemblage structure. Polymerase chain reaction (PCR)-fingerprinting offers a rapid, efficient method for generating genetic markers and was therefore used to obtain an overview on population-genetic structures of the following seven fish species: asp (Aspius aspius), bleak (Alburnus alburnus), blue bream (Abramis ballerus), common bream (Abramis brama), gudgeon (Gobio gobio), ide (Leuciscus idus) and roach (Rutilus rutilus). Of the 20 random primers, between eight (ide) and 18 (roach) produced polymorphic bands. The mean levels of genetic similarity between samples, estimated as bandsharing frequencies, varied between 76% in bleak and 98% in asp. The corresponding genetic distances among samples varied between 0.02 ± 0.01 in asp and 0.24 ± 0.09 in bleak. The genetic distances among samples were not significant in all of the pairwise comparisons, and correlated only weakly with the geographic distances among sampling sites. It was therefore concluded that the stretch of the Elbe surveyed was inhabited by single, panmictic populations of the species studied and thus that the observed habitat preferences, fish distribution, home range and ecological performance of species within this area will depend on stochastic environmental factors or result from biotic interactions. [source] ORIGINAL ARTICLE: Cycads in the insular South-west Pacific: dispersal or vicariance?JOURNAL OF BIOGEOGRAPHY, Issue 6 2008Gunnar Keppel Abstract Aim, Cycads constitute an ancient plant group that is generally believed to disperse poorly. However, one group of cycads (subsection Rumphiae) is thought to have dispersed relatively recently from a Malesian source area westwards to East Africa and eastwards into the Pacific, using a floatation-facilitating layer in their seeds. We use morphological and allozyme characters to investigate the relationships among the species within this group and to deduce whether the wide distribution was achieved by recent dispersal (as evidenced by high genetic similarity) or more distant vicariance events (high genetic differentiation). Location, We examined specimens collected throughout the range of subsection Rumphiae, from East Africa through Southeast Asia to Tonga in the South-west Pacific. Methods, We investigated relationships within subsection Rumphiae of the genus Cycas by analysing 18 variable (11 informative) morphological characters and 22 allozyme loci for seven of the 10 species currently assigned to this taxon. Results, Distinctive morphological characters are few and fail to resolve relationships within the group. Allozyme data show that species within this subsection are closely related and suggest that there are two groups within the subsection, one comprising Cycas thouarsii (East Africa) and C. edentata (the Philippines), and the other the remaining species (from Malesia and the Pacific). The Australian species C. silvestris is sister to subsection Rumphiae in the morphological analysis but is closely allied to C. rumphii (nested within the subsection) in the allozyme analysis, suggesting that Rumphiae may be paraphyletic and that characters thought to be taxonomically important may need to be re-evaluated. Main conclusions, Cycads within subsection Rumphiae are closely related, and the wide distribution of this group was probably achieved through relatively recent oceanic dispersal events. Separate events probably account for the dispersal of these cycads into the Pacific and to Africa. The origin and distribution of C. silvestris (Australia) could be explained by a dispersal event from New Guinea or may have resulted from a former land connection between Australia and New Guinea. [source] Spatial analysis of taxonomic and genetic patterns and their potential for understanding evolutionary historiesJOURNAL OF BIOGEOGRAPHY, Issue 11 2004Sophia A. Bickford Abstract Aim, The aim of this research is to develop and investigate methods for the spatial analysis of diversity based on genetic and taxonomic units of difference. We use monophyletic groups of species to assess the potential for these diversity indices to elucidate the geographical components of macro-scaled evolutionary processes. Location, The range occupied by Pultenaea species in temperate and sub-tropical eastern Australia, extending from western South Australia (133° E,32° S) to Tasmania (146° E,43° S) to coastal central Queensland (148° E,20° S). Methods, We applied a series of both spatially explicit and spatially implicit analyses to explore the nature of diversity patterns in the genus Pultenaea, Fabaceae. We first analysed the eastern species as a whole and then the phylogenetic groups within them. We delineated patterns of endemism and biotic (taxon) regions that have been traditionally circumscribed in biogeographical studies of taxa. Centres of endemism were calculated using corrected weighted endemism at a range of spatial scales. Biotic regions were defined by comparing the similarity of species assemblages of grid cells using the Jaccard index and clustering similar cells using hierarchical clustering. On the basis that genetically coherent areas were likely to be more evolutionary informative than species patterns, genetic indices of similarity and difference were derived. A matrix of similarity distances between taxa was generated based on the number of shared informative characters of two sections of trnL-F and ndhF chloroplast nuclear regions. To identify genetically similar areas, we clustered cells using the mean genetic similarities of the species contained within each pair of cells. Measures of the mean genetic similarity of species in areas were delineated using a geographically local multi-scalar approach. Resultant patterns of genetic diversity are interpreted in relation to theories of the evolutionary relationships between species and species groups. Results, Centres of Pultenaea endemism were defined, those of clades 1 congruent with the spatially separated centres of clades 2 and 3. The taxonomic classification analysis defined cells with shared groups of species, which in some cases clustered when plotted in geographic space, defining biotic regions. In some instances the distribution of biotic regions was congruent with centres of endemism, however larger scale groupings were also apparent. In clade 1 one set of species was replaced by another along the extent of the range, with some connectivity between some geographically disjunct regions due to the presence of widespread species. In the combined analysis of clade 2 and 3 species the major biotic (taxonomic) groups with geographic coherence were defined by species in the respective clades, representing the geographic separation of these clades. However distinctive biotic regions within these main groupings of clades 2 and 3 were also apparent. Clustering cells using the mean genetic similarities of the species contained within each pair of cells indicated that some of the taxonomically defined biotic boundaries were the result of changes in composition of closely related species. This was most apparent in clades 1 and 2 where most cells were highly genetically similar. In clade 3 genetically distinct groups remained and were in part defined by sister taxa with disjunct distributions. Gradients in mean genetic similarity became more apparent from small to larger scales of analysis. At larger scales of analysis, regions of different levels of genetic diversity were delineated. Regions with highest diversity levels (lowest level of similarity) often represented regions where the ranges of phylogenetically distinctive species intergraded. Main conclusions, The combined analysis of diversity, phylogeny and geography has potential to reveal macro-scaled evolutionary patterns from which evolutionary processes may be inferred. The spatial genetic diversity indices developed in this study contribute new methods for identifying coherent evolutionary units in the landscape, which overcome some of the limitations of using taxonomic data, and from which the role of geography in evolutionary processes can be tested. We also conclude that a multiple-index approach to diversity pattern analysis is useful, especially where patterns may be the result of a long history of different environmental changes and related evolutionary events. The analysis contributes to the knowledge of large-scale diversity patterns of Pultenaea which has relevance for the assessment of the conservation status of the genus. [source] Genetic Variability Analysis and Molecular Detection of Fusarium oxysporum f.sp. eustomae Isolated from Eustoma grandiflorum in Northern ItalyJOURNAL OF PHYTOPATHOLOGY, Issue 7-8 2010Yuan Li Abstract A total of 35 isolates of Fusarium oxysporum f.sp. eustomae obtained from diseased Eustoma grandiflorum plants in northern Italy, showing typical Fusarium wilt symptoms, were analysed for their genetic variability and molecular identification. Genetic diversity of the isolates was studied by using random amplified polymorphic DNA (RAPD). This analysis clustered the isolates into three groups at a genetic similarity of 69%. Sequence analysis of RAPD fragments led to the design of a pair of specific primers that amplify a 505-bp SCAR (sequence characterized amplified region) marker (SCAR505) which was used to rapidly detect F. oxysporum f.sp. eustomae on Eustoma grandiflorum plants. In a temperature-controlled chamber, detection of the pathogen by PCR was 100% successful in root and stem samples of infected but still symptomless plants. The diagnostic procedure could be completed in 1 day and allowed rapid and reliable detection of the pathogen in asymptomatic plants in the early stages of disease development. [source] URP-based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of WheatJOURNAL OF PHYTOPATHOLOGY, Issue 4 2010Rashmi Aggarwal Abstract Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs') are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5,GTGTGCGATCAGTTGCTGGG3,) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. [source] Differentiation and Genetic Structure of Sclerophoma pythiophila Strains on Pinus sylvestris in PolandJOURNAL OF PHYTOPATHOLOGY, Issue 7-8 2009Wojciech Kraj Abstract Between 1996 and 2006, 97 strains of Sclerophoma pythiophila were isolated from 3 to 10-year-old trees of Pinus sylvestris from three regions of Poland differing by climatic conditions and geographic location. On the basis of 56 random amplified microsatellites (RAMS) markers obtained with the use of five primers, very high level of genetic variability of strains (mean Jaccard's coefficient 0.56) was ascertained. Among the analysed markers only one was completely monomorphic, whereas six were monomorphic in 90%. Greater genetic similarity was ascertained for strains in southern Poland (0.58) in comparison with strains deriving from northern Poland (0.52). Correlation between the percentage share of polymorphic loci and the average annual temperature of places of strain isolation (r = 0.62) were shown, as well as the number of days with snow cover (r = 0.79). On the basis of the amova analysis, it was ascertained that 11.6% of genetic variability was located between regions of the strains origin and 88.4% within the regions. [source] Morphological and Pathological Variability in Rice Isolates of Rhizoctonia solani and Molecular Analysis of their Genetic VariabilityJOURNAL OF PHYTOPATHOLOGY, Issue 11-12 2007S. Guleria Abstract Nineteen isolates of Rhizoctonia solani collected from different rice varieties grown in various regions of Punjab were studied for their morphological and pathological characterization. Majority of the isolates were fast growing with raised and fluffy colonies and hyphal width of 9.6 ,m while four exhibited moderate growth rate. Colony colour in all except two isolates was light yellowish brown. While sclerotial number per 5.0 mm culture disc of the test isolates ranged between 2.1 and 11.2 mm, their size varied between 1.31 and 2.08 mm. Sclerotial colour in all except two isolates was dark brown and most of these were found scattered in the colony. There was no relationship between morphologically similar isolates and their pathogenic behaviour. Majority of the isolates produced lesion length between 45.6 and 58.2 mm on detached rice leaves (cv. PR116). Molecular characterization of genetic diversity in the test isolates was studied by using 10 inter simple sequence repeats (ISSR) and eight random amplified polymorphic DNA (RAPD) markers. The size of amplified DNA bands ranged from 0.25,3.0 to 0.5,4.0 kb with ISSR and RAPD markers, respectively. Combined data set of 155 DNA markers were analysed with UPGMA resulting five clusters with 49,89% genetic similarity. Most of the isolates showed grouping specific to the host variety. Out of these two types of DNA markers, RAPD markers were able to detect more genetic variability when compared to ISSR markers. [source] TRACING THE ORIGIN OF MULTI-DRUG RESISTANT (MDR) ESCHERICHIA COLI INFECTIONS FROM URINARY CATHETERS IN ICU CANINE PATIENTSJOURNAL OF VETERINARY EMERGENCY AND CRITICAL CARE, Issue S1 2004J Ogeer-Gyles Introduction: Urinary tract infections (UTIs) in dogs with urinary catheters in intensive care units (ICUs) are frequent. Historically, multi-drug resistant (MDR) Escherichia coli account for about 10% of the UTIs. The objectives of this study were to determine the frequency of E. coli infections and of MDR E. coli in dogs with UTIs in our ICU, and to assess whether the MDR E. coli were community-acquired or nosocomial in origin. Methods: Over a 1-year period, rectal swabs were taken from all dogs in the ICU on the day of admission (D0) and on days 3 (D3), 6 (D6), 9 (D9) and 12 (D12). Urine was collected on these days from dogs with an indwelling urinary catheter (n=190). Rectal swabs and urine were routinely cultured. E. coli isolates were identified by biochemical tests. Using NCCLS guidelines, antibiotic susceptibility testing was done by disk diffusion method on fecal and urinary E. coli isolates. Twelve antimicrobial agents were used: nalidixic acid, enrofloxacin, cephalothin, cefoxitin, cefotaxime, ceftiofur, trimethoprim-sulfa, chloramphenicol, gentamicin, tetracycline, ampicillin, and amoxicillin/clavulanate. Pulsed-field gel electrophoresis (PFGE) was used to compare MDR E. coli UTI strains with fecal E. coli strains from the same patient and with MDR fecal E. coli from patients that were adjacent to, or housed in the same cages. Results: E. coli was cultured from 12 (48%) of 25 UTIs. Two of the E. coli were MDR. For one dog, PFGE showed no similarities among fecal E. coli and the urinary MDR E. coli isolates from the patient or between these isolates and fecal E. coli from a dog housed in the same kennel on the previous day. The MDR E. coli UTI was likely acquired prior to admission to the ICU, as it was present on D0. For the other dog, PFGE showed genetic similarity but not complete identity between the D3 MDR E. coli urinary isolate and the D3, D6, D9 fecal MDR isolates. This suggests that the UTI originated with the fecal E. coli. Using selective plates, fecal MDR E. coli were not found on D0. Selection of the MDR strain in the intestine by the use of antibiotics occurred while the dog was in the ICU and possibly led to the UTI. Conclusions: Multi-drug resistant E. coli accounted for 2 of 12 E. coli UTIs in dogs in the ICU over a 1-year period. Genotyping showed that one of the two MDR E. coli infections could possibly be of nosocomial origin. [source] Genetic heterogeneity of non-O1 and non-O139 Vibrio cholerae isolates from shrimp aquaculture system: a comparison of RS-, REP- and ERIC-PCR fingerprinting approachesLETTERS IN APPLIED MICROBIOLOGY, Issue 1 2010B. Madhusudana Rao Abstract Aims:, The genetic diversity of Vibrio cholerae isolated from black tiger shrimp (Penaeus monodon) aquaculture farms was determined using three PCR typing methods based on enterobacterial repetitive intergenic consensus (ERIC) sequences, ribosomal gene spacer (RS) sequence and repetitive extragenic palindromic (REP) sequences. Methods and Results:, Non-O1 and non-O139 V. cholerae isolates were obtained from shrimp pond water, pond sediment, shrimp head and shrimp muscle. RS-PCR yielded fewer bands than REP-PCR and ERIC-PCR. Higher similarity was observed in RS-PCR (75,100%) than in REP-PCR (60,95%) and ERIC-PCR (40,95%). Conclusions:, A 100% similarity between V. cholerae isolates was only noticed in RS-PCR. The choleratoxigenic V. cholerae (non-O1 and non-O139) showed greater genetic similarity with ctx -negative V. cholerae than among ctx- positive V. cholerae. Significance and Impact of the Study:, The greater similarity of ctx -positive V. cholerae with ctx -negative V. cholerae isolates indicates that the ctx -positive strains (non-O1 and non-O139) might have originated from autochthonous V. cholerae in the aquatic niche. [source] Role of adult living donor liver transplantation in patients with hepatitis CLIVER TRANSPLANTATION, Issue 10C 2003Gregory T. Everson Key points 1. Living donor liver transplantation (LDLT) is an option for patients with end-stage liver disease or hepatoma caused by chronic hepatitis C. 2. Reports from some, but not all, transplant centers indicate that hepatitis C may recur earlier, recurrence may be more severe, and graft loss caused by recurrent hepatitis C may be more frequent in LDLT compared with cadaveric transplantation. 3. Several unique characteristics of LDLT (versus cadaveric transplantation) may favor severe recurrence of hepatitis C. These include an increase in genetic similarity between donor and recipient, higher degree of HLA matching, greater systemic bioavailability of immunosuppressive agent, and hepatic regeneration. 4. Hepatic regeneration may promote the acceleration and severity of recurrent hepatitis C by enhancement of hepatitis C viral uptake by hepatocytes through stimulation of the low-density lipoprotein receptor and increase in activity of the internal ribosomal entry site. [source] A quantitative genetic analysis of intermediate asthma phenotypesALLERGY, Issue 3 2009S. F. Thomsen Aim:, To study the relative contribution of genetic and environmental factors to the correlation between exhaled nitric oxide (FeNO), airway responsiveness, airway obstruction, and serum total immunoglobulin E (IgE). Methods:, Within a sampling frame of 21 162 twin subjects, 20,49 years of age, from the Danish Twin Registry, a total of 575 subjects (256 intact pairs and 63 single twins) who either themselves and/or their co-twins reported a history of asthma at a nationwide questionnaire survey, were clinically examined. Traits were measured using standard techniques. Latent factor models were fitted to the observed data using maximum likelihood methods. Results:, Additive genetic factors explained 67% of the variation in FeNO, 43% in airway responsiveness, 22% in airway obstruction, and 81% in serum total IgE. In general, traits had genetically and environmentally distinct variance structures. The most substantial genetic similarity was observed between FeNO and serum total IgE, genetic correlation (,A) = 0.37, whereas the strongest environmental resemblance was observed between airway responsiveness and airway obstruction, specific environmental correlation (,E) = ,0.46, and between FeNO and airway responsiveness, ,E = 0.34. Conclusions:, Asthma is a complex disease characterized by a set of etiologically heterogeneous biomarkers, which likely constitute diverse targets of intervention. [source] Variance components analyses of multiple asthma traits in a large sample of Australian families ascertained through a twin probandALLERGY, Issue 2 2006M. A. R. Ferreira Background:, Intermediate phenotypes are often measured as a proxy for asthma. It is largely unclear to what extent the same set of environmental or genetic factors regulate these traits. Objective:, Estimate the environmental and genetic correlations between self-reported and clinical asthma traits. Methods:, A total of 3073 subjects from 802 families were ascertained through a twin proband. Traits measured included self-reported asthma, airway histamine responsiveness (AHR), skin prick response to common allergens including house dust mite (Dermatophagoides pteronyssinus [D. pter]), baseline lung function, total serum immunoglobulin E (IgE) and eosinophilia. Bivariate and multivariate analyses of eight traits were performed with adjustment for ascertainment and significant covariates. Results:, Overall 2716 participants completed an asthma questionnaire and 2087 were clinically tested, including 1289 self-reported asthmatics (92% previously diagnosed by a doctor). Asthma, AHR, markers of allergic sensitization and eosinophilia had significant environmental correlations with each other (range: 0.23,0.89). Baseline forced expiratory volume in 1 s (FEV1) showed low environmental correlations with most traits. Fewer genetic correlations were significantly different from zero. Phenotypes with greatest genetic similarity were asthma and atopy (0.46), IgE and eosinophilia (0.44), AHR and D. pter (0.43) and AHR and airway obstruction (,0.43). Traits with greatest genetic dissimilarity were FEV1 and atopy (0.05), airway obstruction and IgE (0.07) and FEV1 and D. pter (0.11). Conclusion:, These results suggest that the same set of environmental factors regulates the variation of many asthma traits. In addition, although most traits are regulated to great extent by specific genetic factors, there is still some degree of genetic overlap that could be exploited by multivariate linkage approaches. [source] Inferring ancient Agave cultivation practices from contemporary genetic patternsMOLECULAR ECOLOGY, Issue 8 2010KATHLEEN C. PARKER Abstract Several Agave species have played an important ethnobotanical role since prehistory in Mesoamerica and semiarid areas to the north, including central Arizona. We examined genetic variation in relict Agave parryi populations northeast of the Mogollon Rim in Arizona, remnants from anthropogenic manipulation over 600 years ago. We used both allozymes and microsatellites to compare genetic variability and structure in anthropogenically manipulated populations with putative wild populations, to assess whether they were actively cultivated or the result of inadvertent manipulation, and to determine probable source locations for anthropogenic populations. Wild populations were more genetically diverse than anthropogenic populations, with greater expected heterozygosity, polymorphic loci, effective number of alleles and allelic richness. Anthropogenic populations exhibited many traits indicative of past active cultivation: fixed heterozygosity for several loci in all populations (nonexistent in wild populations); fewer multilocus genotypes, which differed by fewer alleles; and greater differentiation among populations than was characteristic of wild populations. Furthermore, manipulated populations date from a period when changes in the cultural context may have favoured active cultivation near dwellings. Patterns of genetic similarity among populations suggest a complex anthropogenic history. Anthropogenic populations were not simply derived from the closest wild A. parryi stock; instead they evidently came from more distant, often more diverse, wild populations, perhaps obtained through trade networks in existence at the time of cultivation. [source] |