Home About us Contact
|
Home About us Contact | ||
|
|
||
Repression
Kinds of Repression Terms modified by Repression Selected AbstractsREPRESSION OF COMPETITION AND THE EVOLUTION OF COOPERATIONEVOLUTION, Issue 4 2003Steven A. Frank Abstract Repression of competition within groups joins kin selection as the second major force in the history of life shaping the evolution of cooperation. When opportunities for competition against neighbors are limited within groups, individuals can increase their own success only by enhancing the efficiency and productivity of their group. Thus, characters that repress competition within groups promote cooperation and enhance group success. Leigh first expressed this idea in the context of fair meiosis, in which each chromosome has an equal chance of transmission via gametes. Randomized success means that each part of the genome can increase its own success only by enhancing the total number of progeny and thus increasing the success of the group. Alexander used this insight about repression of competition in fair meiosis to develop his theories for the evolution of human sociality. Alexander argued that human social structures spread when they repress competition within groups and promote successful group-against-group competition. Buss introduced a new example with his suggestion that metazoan success depended on repression of competition between cellular lineages. Maynard Smith synthesized different lines of thought on repression of competition. In this paper, I develop simple mathematical models to illustrate the main processes by which repression of competition evolves. With the concepts made clear, I then explain the history of the idea. I finish by summarizing many new developments in this subject and the most promising lines for future study. [source] Compassion and Repression: The Moral Economy of Immigration Policies in FranceCULTURAL ANTHROPOLOGY, Issue 3 2005Didier Fassin Immigration policies in Europe in the last three decades have become increasingly restrictive. During the 1990s, political asylum lost much of its legitimacy, as new criteria based on humanitarian claims became more common in appeals for immigration. Asylum seekers were increasingly identified as illegal immigrants and therefore candidates for expulsion, unless humanitarian reasons could be found to requalify them as victims deserving sympathy. This substitution of a right to asylum by an obligation in terms of charity leads to a reconsideration of Giorgio Agamben's separation of the humanitarian and the political, suggesting instead a humanitarianization of policies. Sangatte Center, often referred to as a transit camp, became a symbol of this ambiguous European treatment of the "misery of the world" and serves here as an analytical thread revealing the tensions between repression and compassion as well as the moral economy of contemporary biopolitics. [source] Transient expression of thyroid hormone nuclear receptor TR,2 sets S opsin patterning during cone photoreceptor genesisDEVELOPMENTAL DYNAMICS, Issue 5 2007M.L. Applebury Abstract Cone photoreceptors in the murine retina are patterned by dorsal repression and ventral activation of S opsin. TR,2, the nuclear thyroid hormone receptor , isoform 2, regulates dorsal repression. To determine the molecular mechanism by which TR,2 acts, we compared the spatiotemporal expression of TR,2 and S opsin from embryonic day (E) 13 through adulthood in C57BL/6 retinae. TR,2 and S opsin are expressed in cone photoreceptors only. Both are transcribed by E13, and their levels increase with cone genesis. TR,2 is expressed uniformly, but transiently, across the retina. mRNA levels are maximal by E17 at completion of cone genesis and again minimal before P5. S opsin is also transcribed by E13, but only in ventral cones. Repression in dorsal cones is established by E17, consistent with the occurrence of patterning during cone cell genesis. The uniform expression of TR,2 suggests that repression of S opsin requires other dorsal-specific factors in addition to TR,2. The mechanism by which TR,2 functions was probed in transgenic animals with TR,2 ablated, TR,2 that is DNA binding defective, and TR,2 that is ligand binding defective. These studies show that TR,2 is necessary for dorsal repression, but not ventral activation of S opsin. TR,2 must bind DNA and the ligand T3 (thyroid hormone) to repress S opsin. Once repression is established, T3 no longer regulates dorsal S opsin repression in adult animals. The transient, embryonic action of TR,2 is consistent with a role (direct and/or indirect) in chromatin remodeling that leads to permanent gene silencing in terminally differentiated, dorsal cone photoreceptors. Developmental Dynamics 236:1203,1212, 2007. © 2007 Wiley-Liss, Inc. [source] Modernizing Repression: Police Training, Political Violence, and Nation-Building in the "American Century"DIPLOMATIC HISTORY, Issue 2 2009Jeremy Kuzmarov First page of article [source] Cooption and Repression in the Soviet UnionECONOMICS & POLITICS, Issue 1 2001Dmitriy Gershenson The Soviet ruling elite, the nomenklatura, used both cooption and political repression to encourage loyalty to the communist regime. Loyalty was critical both in defusing internal opposition to the rule of the nomenklatura and in either deterring or defeating foreign enemies of the Soviet Union. The cost of coopting people into the Communist Party was a decrease in the standard of living of members of the nomenklatura, whereas the cost of political repression was the danger that members of the nomenklatura would themselves be victimized. We assume that the nomenklatura determined the extent of cooption and the intensity of political repression by equating perceived marginal benefits and marginal costs. We use this assumption to construct an account of the historical evolution of policies of cooption and political repression in the Soviet Union. [source] REPRESSION OF COMPETITION AND THE EVOLUTION OF COOPERATIONEVOLUTION, Issue 4 2003Steven A. Frank Abstract Repression of competition within groups joins kin selection as the second major force in the history of life shaping the evolution of cooperation. When opportunities for competition against neighbors are limited within groups, individuals can increase their own success only by enhancing the efficiency and productivity of their group. Thus, characters that repress competition within groups promote cooperation and enhance group success. Leigh first expressed this idea in the context of fair meiosis, in which each chromosome has an equal chance of transmission via gametes. Randomized success means that each part of the genome can increase its own success only by enhancing the total number of progeny and thus increasing the success of the group. Alexander used this insight about repression of competition in fair meiosis to develop his theories for the evolution of human sociality. Alexander argued that human social structures spread when they repress competition within groups and promote successful group-against-group competition. Buss introduced a new example with his suggestion that metazoan success depended on repression of competition between cellular lineages. Maynard Smith synthesized different lines of thought on repression of competition. In this paper, I develop simple mathematical models to illustrate the main processes by which repression of competition evolves. With the concepts made clear, I then explain the history of the idea. I finish by summarizing many new developments in this subject and the most promising lines for future study. [source] IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domainFEBS JOURNAL, Issue 24 2006Gopal P. Patel Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5, untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nm and 5.9 nm, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3, end of the ARS. Results of our analysis suggest that both protein·protein and protein·RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA. [source] Identification of direct and indirect targets of the Gln3 and Gat1 activators by transcriptional profiling in response to nitrogen availability in the short and long termFEMS YEAST RESEARCH, Issue 5 2006Bart Scherens Abstract Nitrogen catabolite repression (NCR) consists in the specific inhibition of transcriptional activation of genes encoding the permeases and catabolic enzymes needed to degrade poor nitrogen sources. Under nitrogen limitation or rapamycin treatment, NCR genes are activated by Gln3 or Gat1, or by both factors. To compare the sets of genes responding to rapamycin or to nitrogen limitation, we used DNA microarrays to establishing the expression profiles of a wild type strain, and of a double gln3,,gat1, strain, grown on glutamine, after addition of rapamycin, on proline, or after a shift from glutamine to proline. Analysis of microarray data revealed 392 genes whose expression was dependent on the nitrogen source quality. 91 genes were activated in a GATA factor-dependent manner in all growth conditions, suggesting a direct role of Gln3 and Gat1 in their expression. Other genes were only transiently up-regulated (stress-responsive genes) or down-regulated (genes encoding ribosomal proteins and translational factors) upon nitrogen limitation, and this regulation was delayed in a gln3,,gat1, strain. Repression of amino acid and nucleotide biosynthetic genes after a nitrogen shift did not depend on Gcn4. Several transporter genes were repressed as a consequence of enhanced levels of NCR-responsive permeases present at the plasma membrane. [source] Upregulation of myosin Va by Snail is involved in cancer cell migration and metastasisINTERNATIONAL JOURNAL OF CANCER, Issue 1 2010Linxiang Lan Abstract Cell migration, which involves acto-myosin dynamics, cell adhesion, membrane trafficking and signal transduction, is a prerequisite for cancer cell metastasis. Here, we report that an actin-dependent molecular motor, unconventional myosin Va, is involved in this process and implicated in cancer metastasis. The mRNA expression of myosin Va is increased in a number of highly metastatic cancer cell lines and metastatic colorectal cancer tissues. Suppressing the expression of myosin Va by lentivirus-based RNA interference in highly metastatic cancer cells impeded their migration and metastasis capabilities both in vitro and in vivo. In addition, the levels of myosin Va in cancer cell lines are positively correlated with the expression of Snail, a transcriptional repressor that triggers epithelial,mesenchymal transition. Repression or overexpression of Snail in cancer cells caused reduced or elevated levels of myosin Va, respectively. Furthermore, Snail can bind to an E-box of the myosin Va promoter and induce its activity, which indicates that Snail might act as a transcriptional activator. These data demonstrate an essential role of myosin Va in cancer cell migration and metastasis, and suggest a novel target for Snail in its regulation of cancer progression. [source] "A Hand upon the Throat of the Nation": Economic Sanctions and State Repression, 1976,2001INTERNATIONAL STUDIES QUARTERLY, Issue 3 2008Reed M. Wood While intended as a nonviolent foreign policy alternative to military intervention, sanctions have often worsened humanitarian and human rights conditions in the target country. This article examines the relationship between economic sanctions and state-sponsored repression of human rights. Drawing on both the public choice and institutional constraints literature, I argue that the imposition of economic sanctions negatively impacts human rights conditions in the target state by encouraging incumbents to increase repression. Specifically, sanctions threaten the stability of target incumbents, leading them to augment their level of repression in an effort to stabilize the regime, protect core supporters, minimize the threat posed by potential challengers, and suppress popular dissent. The empirical results support this theory. These findings provide further evidence that sanctions impose political, social, and physical hardship on civilian populations. They also underscore a need for improvements in current strategies and mechanisms by which states pursue foreign-policy goals and the international community enforces international law and stability. [source] JNK signaling in insulin-producing cells is required for adaptive responses to stress in DrosophilaAGING CELL, Issue 3 2009Jason Karpac Summary Adaptation to environmental challenges is critical for the survival of an organism. Repression of Insulin/IGF Signaling (IIS) by stress-responsive Jun-N-terminal Kinase (JNK) signaling is emerging as a conserved mechanism that allows reallocating resources from anabolic to repair processes under stress conditions. JNK activation in Insulin-producing cells (IPCs) is sufficient to repress Insulin and Insulin-like peptide (ILP) expression in rats and flies, but the significance of this interaction for adaptive responses to stress is unclear. In this study, it is shown that JNK activity in IPCs of flies is required for oxidative stress-induced repression of the Drosophila ILP2. It is found that this repression is required for growth adaptation to heat stress as well as adult oxidative stress tolerance, and that induction of stress response genes in the periphery is in part dependent on IPC-specific JNK activity. Endocrine control of IIS by JNK in IPCs is thus critical for systemic adaptation to stress. [source] To Rise in Darkness: Revolution, Repression, and Memory in El Salvador, 1920,1932JOURNAL OF LATIN AMERICAN & CARIBBEAN ANTHROPOLOGY, Issue 2 2008Ellen Moodie First page of article [source] Identification of a 251-bp Fragment of the PAI-1 Gene Promoter That Mediates the Ethanol-Induced Suppression of PAI-1 ExpressionALCOHOLISM, Issue 5 2001Hernan E. Grenett Background: Moderate alcohol consumption reduces the risk for coronary heart disease. This cardioprotection may be due to ethanol enhancement of fibrinolysis. Fibrinolysis involves the interaction of plasminogen activators (PAs) and the plasminogen activator inhibitor type-1 (PAI-1). Factor(s) that decrease endothelial cell (EC) PAI-1 expression increase fibrinolysis and may decrease the risk for cardiovascular disease. Methods: Five promoter deletion fragments were generated from a 1.1-kb PAI-1 promoter fragment and ligated to a luciferase reporter gene. Cultured human umbilical vein endothelial cells (HUVECs) were transiently transfected with these PAI-1 deletion constructs. A 251-base pair (bp) fragment of the PAI-1 promoter, positions ,800 to ,549, was cloned upstream of a heterologous promoter/enhancer. ECs luciferase activity was measured in the absence/presence of 20 mM ethanol. Electrophoresis mobility shift assays were performed with nuclear extracts from untreated and ethanol-treated ECs using this 251-bp fragment. Results: Deletion analysis showed a region between position ,800 and ,549 mediated ethanol repression of luciferase activity. This 251-bp promoter fragment also repressed the activity of a heterologous promoter/enhancer in the presence of ethanol. Using the labeled 251-bp fragment, nuclear extracts from ethanol-treated ECs contained two inducible bands and one enhanced band. Non-ethanol treated nuclear extracts also contained a band that was not observed in ethanol-treated samples. Competition using 100-fold molar excess of unlabeled probe abolished these four bands. Conclusions: Repression of PAI-I gene transcription in cultured HUVECs exposed to ethanol may involve the interaction of several transcription factors with binding sites localized between positions ,800 and ,549 of the PAI-1 gene promoter. [source] Transnational Corporations and Repression of Political Rights and Civil Liberties: An Empirical AnalysisKYKLOS INTERNATIONAL REVIEW OF SOCIAL SCIENCES, Issue 1 2004Matthias Busse Summary Transnational Corporations are often accused by non-governmental organisations of ignoring fundamental democratic rights, such as civil liberties and political rights, in the countries of their investments. This paper attempts to explore empirically the complex relationship between foreign investment and democracy in a systematic way, using different econometric techniques. In contrast to the public discussion over recent years and the view held by non-governmental organisations, the results show that enhanced democratic rights are associated with higher foreign investment in the 1990s. Interestingly, this positive link does not hold for the 1970s and 1980s, when a substantial portion of foreign investment went to countries with repressive governments. [source] Regulation of AmtR-controlled gene expression in Corynebacterium glutamicum: mechanism and characterization of the AmtR regulonMOLECULAR MICROBIOLOGY, Issue 2 2005Gabriele Beckers Summary AmtR, the master regulator of nitrogen control in Corynebacterium glutamicum, represses transcription of a number of genes during nitrogen surplus. Repression is released by an interaction of AmtR with signal transduction protein GlnK. As shown by pull-down assays and gel retardation experiments, only adenylylated GlnK, which is present in the cells during nitrogen limitation, is able to bind to AmtR. The AmtR regulon was characterized in this study by a combination of bioinformatics, transcriptome and proteome analyses. At least 33 genes are directly controlled by the repressor protein including those encoding transporters and enzymes for ammonium assimilation (amtA, amtB, glnA, gltBD), urea and creatinine metabolism (urtABCDE, ureABCEFGD, crnT, codA), a number of biochemically uncharacterized enzymes and transport systems (NCgl1099, NCgl1100, NCgl 1915,1918) as well as signal transduction proteins (glnD, glnK). For the AmtR regulon, an AmtR box has been defined which comprises the sequence tttCTATN6AtAGat/aA. Furthermore, the transcriptional organization of AmtR-regulated genes and operons was characterized. [source] Repression of virulence genes by phosphorylation-dependent oligomerization ofCsrR at target promoters in S. pyogenesMOLECULAR MICROBIOLOGY, Issue 4 2001Alita A. Miller csrRS encodes a two-component regulatory system that represses the transcription of a number of virulence factors in Streptococcus pyogenes, including the hyaluronic acid capsule and pyrogenic exotoxin B. CsrRS-regulated virulence factors have diverse functions during pathogenesis and are differentially expressed throughout growth. This suggests that multiple signals induce CsrRS-mediated gene regulation, or that regulated genes respond differently to CsrR, or both. As a first step in dissecting the csrRS signal transduction pathway, we determined the mechanism by which CsrR mediates the repression of its target promoters. We found that phosphorylated CsrR binds directly to all but one of the promoters of its regulated genes, with different affinities. Phosphorylation of CsrR enhances both oligomerization and DNA binding. We defined the binding site of CsrR at each of the regulated promoters using DNase I and hydroxyl radical footprinting. Based on these results, we propose a model for differential regulation by CsrRS. [source] Regulation of Arabidopsis thaliana 4-coumarate:coenzyme-A ligase-1 expression by artificial zinc finger chimerasPLANT BIOTECHNOLOGY JOURNAL, Issue 1 2006Juan Pablo Sánchez Summary The use of artificial zinc finger chimeras to manipulate the expression of a gene of interest is a promising approach because zinc finger proteins can be engineered to bind any given DNA sequence in the genome. We have previously shown that a zinc finger chimera with a VP16 activation domain can activate a reporter gene in transgenic Arabidopsis thaliana (Sánchez, J.P., Ullman, C., Moore, M., Choo, Y. and Chua, N.H. (2002) Regulation of gene expression in Arabidopsis thaliana by artificial zinc finger chimeras. Plant Cell Physiol. 43, 1465,1472). Here, we report the use of artificial zinc finger chimeras to specifically regulate the 4-coumarate:coenzyme-A ligase-1 (At4CL1) gene in A. thaliana. At4CL1 is a key enzyme in lignin biosynthesis and the down-regulation of At4CL1 can lead to a decrease in lignin content, which has a significant commercial value for the paper industry. To this end, we designed zinc finger chimeras containing either an activation or a repression domain, which bind specifically to the At4CL1 promoter region. Transgenic lines expressing a zinc finger chimera with the VP16 activation domain showed an increase in At4CL1 expression and enzyme activity. In contrast, transgenic lines expressing a chimera with the KOX (KRAB) repression domain displayed repression of At4CL1 expression and enzyme activity. The activation of At4CL1 expression produced an increase in lignin content, and transgenic plant stems showed ectopic lignin distribution. Repression of the At4CL1 gene resulted in reduced lignin content, and lignin distribution in transgenic stems was severely diminished. Our results confirm and extend previous studies of gene regulation using various artificial zinc finger chimeras in animal and plant systems, and show that this system can be used to up- and down-regulate the expression of an endogenous plant gene such as At4CL1. [source] Human Rights Violations, Corruption, and the Policy of RepressionPOLICY STUDIES JOURNAL, Issue 1 2008Alok K. Bohara Quantitative cross-national research on human rights violations and repression has made considerable progress in identifying and eliminating economic and political factors that influence the use of torture and killing by governments. Warfare tends to increase violations, democracy,notably full democracy,and trade tends to inhibit violations. Where motives have been considered, this research has generally assumed a strategic motivation for government use of repression. Repression is employed to counter threats from the opposition as represented by the presence of warfare. Less attention has been given to the effect of implementation on levels of repression. Theory suggests that agents are likely to make a substantial independent contribution to the level of repression, if given the opportunity. In this article we develop this argument and present cross-country comparative evidence that suggests that agents' opportunities for hidden action measured by perceived levels of financial corruption substantially influences the incidence of torture in a political system, after controlling for the strategic motive of governments and the other factors found influential in earlier research. We show that the results are robust and not sensitive to alternative modeling, measurement, and research-design decisions. [source] I'll Take the High Road: Two Pathways to Altruistic Political Mobilization Against Regime Repression in ArgentinaPOLITICAL PSYCHOLOGY, Issue 3 2001Kristina E. Thalhammer What led Argentine human rights activists to risk challenging state repression in the late 1970s? Chi-square analyses of 78 interviews with early activists and nonactivists suggested few commonalities among activists but revealed two distinct and inverse routes to high-risk other-centered political activism. Activists directly affected by regime violence tended to be relatively inexperienced politically, to have little experience with fear, and to see groups as comprising individuals rather than as monolithic wholes. An inverse pattern characterized activists not directly affected by regime violence: Their activism was preceded by experience in politics and survival of previous fear-evoking episodes. [source] Terror and Democracy in the Age of Stalin: The Social Dynamics of Repression , By Wendy Z. GoldmanTHE HISTORIAN, Issue 3 2010Lesley A. Rimmel No abstract is available for this article. [source] Ending the French Revolution: Violence, Justice, and Repression from the Terror to Napoleon , By Howard G. BrownTHE HISTORIAN, Issue 4 2007Janet D. Stone No abstract is available for this article. [source] Repression, transference and reconstructionTHE INTERNATIONAL JOURNAL OF PSYCHOANALYSIS, Issue 3 2003Harold P. Blum Whereas Peter Fonagy almost dismisses the importance of repression and the recovery of repressed and suppressed memory, the author believes that the analysis of repression retains importance in clinical psychoanalysis. Transference is a return of the repressed, with repressed memories embedded within a fundamental unconscious fantasy constellation. Moreover, transference is an essential, but not the only, route to the understanding and analysis of the patient. Nor should transference be confused with the real or new analytic relationship. The author does not regard the dynamic unconscious as definitely registered and retrieved in procedural memory, awaiting further research. A focus on the present ,self with other' model of therapeutic action neglects pathogenesis and the importance of childhood and its psychoanalytic reconstruction. [source] Repression of light signaling by Arabidopsis SPA1 involves post-translational regulation of HFR1 protein accumulationTHE PLANT JOURNAL, Issue 1 2005Jianping Yang Summary Arabidopsis uses two major classes of photoreceptors to mediate seedling de-etiolation. The cryptochromes (cry1 and cry2) absorb blue/ultraviolet-A light, whereas the phytochromes (phyA,phyE) predominantly regulate responses to red/far-red light. Arabidopsis COP1 represses light signaling by acting as an E3 ubiquitin ligase in the nucleus, and is responsible for targeted degradation of a number of photomorphogenesis-promoting factors, including HY5, LAF1, phyA, and HFR1. Distinct light signaling pathways initiated by multiple photoreceptors (including both phytochromes and cryptochromes) eventually converge on COP1, causing its inactivation and nuclear depletion. Arabidopsis SPA1, which encodes a protein structurally related to COP1, also represses light signaling under various light conditions. In this study, we present genetic evidence supporting that HFR1, which encodes a photomorphogenesis-promoting bHLH transcription factor, acts downstream of SPA1 and is required for different subsets of branch pathways of light signaling controlled by SPA1 under different light conditions. We show that SPA1 physically interacts with HFR1 in a yeast two-hybrid assay and an in vitro co-immunoprecipitation assay. We demonstrate that higher levels of HFR1 protein accumulate in the spa1 mutant background under various light conditions, including far-red, red, blue, and white light, whereas a marginal increase in HFR1 transcript level is only seen in dark- and far-red light-grown spa1-100 mutants. Together, our data suggest that repression of light signaling by Arabidopsis SPA1 likely involves post-translational regulation of HFR1 protein accumulation. [source] The Very Mark of Repression: The Demolition Theatre of the Palast der Republik and the New Schloss BerlinARCHITECTURAL DESIGN, Issue 5 2010Khadija Caroll La Abstract Built on the site of the Imperial Palace in East Berlin, the Palast der Republik was erected by the Soviets in 1976 as a direct expression of their power. As new plans are afoot for a replacement institution on the site of the demolished palast, KhadijaCarrollLa traces ,the traumatic process of becoming, of construction, destruction and theatrical re-enactment'. Copyright © 2010 John Wiley & Sons, Ltd. [source] Nonlinear Dynamics of Regulation of Bacterial trpOperon: Model Analysis of Integrated Effects of Repression, Feedback Inhibition, and AttenuationBIOTECHNOLOGY PROGRESS, Issue 4 2002Zhi-Long Xiu The trpoperon encodes the five genes for the enzymes required to convert chorismate to tryptophan, and its switching on and off is controlled by both feedback repression and attenuation in response to different levels of tryptophan in the cell. Repression of the operon occurs when tryptophan concentration is high, and attenuation fine-tunes the transcription level at a lower cellular concentration of tryptophan. An extended mathematical model is established in this study to describe the switching on and off of the trpoperon by considering the integrated effects of repression and attenuation. The influences of cell growth rate on the biosynthesis of tryptophan, stability and dynamic behavior of the trpoperon are investigated. Sustained oscillations of tryptophan levels are predicted from the regulated turning on and off of the trpoperon. It is interesting to note that during such oscillations the regulation of transcription displays a kind of "on" and "off" state in terms of gene expression, indicating the existence of a genetic circuit or switch in the regulation of the trpoperon. Time lags between transcription and translation are also predicted and may explain the occurrence of such oscillation phenomenon. [source] Thyroid hormone receptor , can control action potential duration in mouse ventricular myocytes through the KCNE1 ion channel subunitACTA PHYSIOLOGICA, Issue 2 2010A. Mansén Abstract Aims:, The reduced heart rate and prolonged QTend duration in mice deficient in thyroid hormone receptor (TR) ,1 may involve aberrant expression of the K+ channel ,-subunit KCNQ1 and its regulatory ,-subunit KCNE1. Here we focus on KCNE1 and study whether increased KCNE1 expression can explain changes in cardiac function observed in TR,1-deficient mice. Methods:, TR-deficient, KCNE1-overexpressing and their respective wildtype (wt) mice were used. mRNA and protein expression were assessed with Northern and Western blot respectively. Telemetry was used to record electrocardiogram and temperature in freely moving mice. Patch-clamp was used to measure action potentials (APs) in isolated cardiomyocytes and ion currents in Chinese hamster ovary (CHO) cells. Results:, KCNE1 was four to 10-fold overexpressed in mice deficient in TR,1. Overexpression of KCNE1 with a heart-specific promoter in transgenic mice resulted in a cardiac phenotype similar to that in TR,1-deficient mice, including a lower heart rate and prolonged QTend time. Cardiomyocytes from KCNE1-overexpressing mice displayed increased AP duration. CHO cells transfected with expression plasmids for KCNQ1 and KCNE1 showed an outward rectifying current that was maximal at equimolar plasmids for KCNQ1-KCNE1 and decreased at higher KCNE1 levels. Conclusion:, The bradycardia and prolonged QTend time in hypothyroid states can be explained by altered K+ channel function due to decreased TR,1-dependent repression of KCNE1 expression. [source] Compassion and Repression: The Moral Economy of Immigration Policies in FranceCULTURAL ANTHROPOLOGY, Issue 3 2005Didier Fassin Immigration policies in Europe in the last three decades have become increasingly restrictive. During the 1990s, political asylum lost much of its legitimacy, as new criteria based on humanitarian claims became more common in appeals for immigration. Asylum seekers were increasingly identified as illegal immigrants and therefore candidates for expulsion, unless humanitarian reasons could be found to requalify them as victims deserving sympathy. This substitution of a right to asylum by an obligation in terms of charity leads to a reconsideration of Giorgio Agamben's separation of the humanitarian and the political, suggesting instead a humanitarianization of policies. Sangatte Center, often referred to as a transit camp, became a symbol of this ambiguous European treatment of the "misery of the world" and serves here as an analytical thread revealing the tensions between repression and compassion as well as the moral economy of contemporary biopolitics. [source] The taurine transporter: mechanisms of regulationACTA PHYSIOLOGICA, Issue 1-2 2006X. Han Abstract Taurine transport undergoes an adaptive response to changes in taurine availability. Unlike most amino acids, taurine is not metabolized or incorporated into protein but remains free in the intracellular water. Most amino acids are reabsorbed at rates of 98,99%, but reabsorption of taurine may range from 40% to 99.5%. Factors that influence taurine accumulation include ionic environment, electrochemical charge, and post-translational and transcriptional factors. Among these are protein kinase C (PKC) activation and transactivation or repression by proto-oncogenes such as WT1, c-Jun, c-Myb and p53. Renal adaptive regulation of the taurine transporter (TauT) was studied in vivo and in vitro. Site-directed mutagenesis and the oocyte expression system were used to study post-translational regulation of the TauT by PKC. Reporter genes and Northern and Western blots were used to study transcriptional regulation of the taurine transporter gene (TauT). We demonstrated that (i) the body pool of taurine is controlled through renal adaptive regulation of TauT in response to taurine availability; (ii) ionic environment, electrochemical charge, pH, and developmental ontogeny influence renal taurine accumulation; (iii) the fourth segment of TauT is involved in the gating of taurine across the cell membrane, which is controlled by PKC phosphorylation of serine 322 at the post-translational level; (iv) expression of TauT is repressed by the p53 tumour suppressor gene and is transactivated by proto-oncogenes such as WT1, c-Jun, and c-Myb; and (v) over-expression of TauT protects renal cells from cisplatin-induced nephrotoxicity. [source] Mi-2 chromatin remodeling factor functions in sensory organ development through proneural gene repression in DrosophilaDEVELOPMENT GROWTH & DIFFERENTIATION, Issue 7 2006Yasutoyo Yamasaki Mi-2, the central component of the nucleosome remodeling and histone deacetylation (NuRD) complex, is known as an SNF2-type ATP-dependent nucleosome remodeling factor. No morphological mutant phenotype of Drosophila Mi-2 (dMi-2) had been reported previously; however, we found that rare escapers develop into adult flies showing an extra bristle phenotype. The dMi-2 enhanced the phenotype of acHw49c, which is a dominant gain-of-function allele of achaete (ac) and produces extra bristles. Consistent with these observations, the ac -expressing proneural clusters were expanded, and extra sensory organ precursors (SOP) were formed in the dMi-2 mutant wing discs. Immunostaining of polytene chromosomes showed that dMi-2 binds to the ac locus, and dMi-2 and acetylated hisotones distribute on polytene chromosomes in a mutually exclusive manner. The chromatin immunoprecipitation assay of the wing imaginal disc also demonstrated a binding of dMi-2 on the ac locus. These results suggest that the Drosophila Mi-2/NuRD complex functions in neuronal differentiation through the repression of proneural gene expression by chromatin remodeling and histone deacetylation. [source] Genetic basis of rett syndromeDEVELOPMENTAL DISABILITIES RESEARCH REVIEW, Issue 2 2002Ignatia B. Van den Veyver Abstract The origin of Rett syndrome has long been debated, but several observations have suggested an X-linked dominant inheritance pattern. We and others have pursued an exclusion-mapping strategy using DNA from a small number of familial Rett syndrome cases. This work resulted in the narrowing of the region likely to harbor the mutated gene to Xq27.3-Xqter. After systematic exclusion of several candidate genes, we discovered mutations in MECP2, the gene that encodes the transcriptional repressor, methyl-CpG-binding protein 2. Since then, nonsense, missense, or frameshift mutations have been found in at least 80% of girls affected with classic Rett syndrome. Sixty-four percent of mutations are recurrent C > T transitions at eight CpG dinucleotides mutation hotspots, while the C-terminal region of the gene is prone to recurrent multinucleotide deletions (11%). Most mutations are predicted to result in total or partial loss of function of MeCP2. There is no clear correlation between the type and position of the mutation and the phenotypic features of classic and variant Rett syndrome patients, and XCI appears to be a major determinant of phenotypic severity. Further research focuses on the pathogenic consequences of these mutations along the hypothesis of loss of transcriptional repression of a small number of genes that are essential for neuronal function in the maturing brain. MRDD Research Reviews 2002;8:82,86. © 2002 Wiley-Liss, Inc. [source] | |||||||||||||||||||||||||||||||||||||||||||