Home About us Contact
|
Home About us Contact | ||
|
|
||
RNA-binding Domain (RNA-bind + domain)
Selected AbstractsStructural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron DNA-insertion functionFEBS JOURNAL, Issue 1 2010María D. Molina-Sánchez Group II introns are both catalytic RNAs and mobile retroelements that move through a process catalyzed by a RNP complex consisting of an intron-encoded protein and the spliced intron lariat RNA. Group II intron-encoded proteins are multifunctional and contain an N-terminal reverse transcriptase domain, followed by a putative RNA-binding domain (domain X) associated with RNA splicing or maturase activity and a C-terminal DNA binding/DNA endonuclease region. The intron-encoded protein encoded by the mobile group II intron RmInt1, which lacks the DNA binding/DNA endonuclease region, has only a short C-terminal extension (C-tail) after a typical domain X, apparently unrelated to the C-terminal regions of other group II intron-encoded proteins. Multiple sequence alignments identified features of the C-terminal portion of the RmInt1 intron-encoded protein that are conserved throughout evolution in the bacterial ORF class D, suggesting a group-specific functionally important protein region. The functional importance of these features was demonstrated by analyses of deletions and mutations affecting conserved amino acid residues. We found that the C-tail of the RmInt1 intron-encoded protein contributes to the maturase function of this reverse transcriptase protein. Furthermore, within the C-terminal region, we identified, in a predicted ,-helical region and downstream, conserved residues that are specifically required for the insertion of the intron into DNA targets in the orientation that would make it possible to use the nascent leading strand as a primer. These findings suggest that these group II intron intron-encoded proteins may have adapted to function in mobility by different mechanisms to make use of either leading or lagging-oriented targets in the absence of an endonuclease domain. [source] Relevance of translocation type in myxoid liposarcoma and identification of a novel EWSR1-DDIT3 fusionGENES, CHROMOSOMES AND CANCER, Issue 11 2007B. Bode-Lesniewska The clinical course of myxoid/round cell liposarcoma (MRCL) is characterized by frequent local recurrences and metastases at unusual sites. MRCLs carry specific translocations, t(12;16) or rarely t(12;22), linking the FUS or the EWSR1 gene with the DDIT3 gene, respectively. Nine FUS/DDIT3 and three EWSR1/DDIT3 variants of fusion transcripts have been described thus far. In search of prognostic markers for MRCL, we analyzed the translocation types of 31 patients and related them to the event free and overall survival. Using break-apart FISH and RT-PCR combined with DNA sequencing, we detected FUS/DDIT3 fusions in 30 sarcomas, while an EWSR1/DDIT3 translocation was identified in one tumor. FUS/DDIT3 type II (exons 5-2) was most commonly detected (20 cases), followed by type I (7-2) (7 cases) and type III (8-2) (3 cases). A single tumor carrying a t(12;22) translocation expressed a hitherto unknown EWSR1-DDIT3 fusion transcript (13-3) linking the complete RNA-binding domain of EWSR1 with a short piece of the 5,-UTR and the entire open reading frame of the DDIT3 gene. Interestingly, five of six patients with type I (7-2) FUS/DDIT3 fusions displayed local recurrences and/or metastatic spread within the first 3 years, generally requiring chemotherapeutical treatment (median disease-free survival 17 months). In contrast, 9 of 13 patients with type II FUS/DDIT3 translocations remained at 3 years disease-free (median disease-free survival 75 months). Since the total number of patients is still limited, further studies are required to verify a putative association of type I FUS/DDIT3 -fusion transcripts with a prognosis of MRCL. © 2007 Wiley-Liss, Inc. [source] Identification and gene expression profiling of the Pum1 and Pum2 members of the Pumilio family in the chickenMOLECULAR REPRODUCTION & DEVELOPMENT, Issue 1 2008Jee Young Lee Abstract Members of the Pumilio (Pum) family of RNA-binding proteins act as translational repressors and are required for germ cell development and asymmetric division. We identified the chicken Pum1 and Pum2 genes and analyzed their expression patterns in various tissues. Comparative sequence analysis of the Pum1 and Pum2 proteins from the drosophila, chicken, mouse, and human revealed a high degree of evolutionary conservation in terms of the levels of homology of the peptide sequences and the structure of Pumilio homology domain (PUM-HD), C-terminal RNA-binding domain, with similar spacing between the adjacent Pum eight tandem repeats. In addition, phylogenetic patterns of pumilio family showed that Pum 1 and 2 of chicken are more closely related to those of mouse and human than other species and Pum1 is more conserved than Pum2. Using real-time RT-PCR, the expression levels of the Pum1 and Pum2 genes were found to be highest in hatched female gonads, and high-level expression of Pum2 was detected in 12-day and hatched gonads among the various chicken embryonic tissues tested. In adult tissues, the expression levels of Pum1 and Pum2 were expressed at higher levels in the testis and muscle than in any other tissue. The characteristics of the tissue-specific expression of Pum genes suggest that Pum1 and Pum2 have effects crucially in particular stage during development of chicken gonads depending on sexual maturation. Mol. Reprod. Dev. 75: 184,190, 2008. © 2007 Wiley-Liss, Inc. [source] Precursor complex structure of pseudouridine synthase TruB suggests coupling of active site perturbations to an RNA-sequestering peripheral protein domainPROTEIN SCIENCE, Issue 8 2005Charmaine Hoang Abstract The pseudouridine synthase TruB is responsible for the universally conserved post-transcriptional modification of residue 55 of elongator tRNAs. In addition to the active site, the "thumb," a peripheral domain unique to the TruB family of enzymes, makes extensive interactions with the substrate. To coordinate RNA binding and release with catalysis, the thumb may be able to sense progress of the reaction in the active site. To establish whether there is a structural correlate of communication between the active site and the RNA-sequestering thumb, we have solved the structure of a catalytically inactive point mutant of TruB in complex with a substrate RNA, and compared it to the previously determined structure of an active TruB bound to a reaction product. Superposition of the two structures shows that they are extremely similar, except in the active site and, intriguingly, in the relative position of the thumb. Because the two structures were solved using isomorphous crystals, and because the thumb is very well ordered in both structures, the displacement of the thumb we observe likely reflects preferential propagation of active site perturbations to this RNA-binding domain. One of the interactions between the active site and the thumb involves an active site residue whose hydrogen-bonding status changes during the reaction. This may allow the peripheral RNA-binding domain to monitor progress of the pseudouridylation reaction. [source] What can we learn by computing 13C, chemical shifts for X-ray protein models?ACTA CRYSTALLOGRAPHICA SECTION D, Issue 7 2009Yelena A. Arnautova The room-temperature X-ray structures of ubiquitin (PDB code 1ubq) and of the RNA-binding domain of nonstructural protein 1 of influenza A virus (PDB code 1ail) solved at 1.8 and 1.9,Å resolution, respectively, were used to investigate whether a set of conformations rather than a single X-ray structure provides better agreement with both the X-ray data and the observed 13C, chemical shifts in solution. For this purpose, a set of new conformations for each of these proteins was generated by fitting them to the experimental X-ray data deposited in the PDB. For each of the generated structures, which show R and Rfree factors similar to those of the deposited X-ray structure, the 13C, chemical shifts of all residues in the sequence were computed at the DFT level of theory. The sets of conformations were then evaluated by their ability to reproduce the observed 13C, chemical shifts by using the conformational average root-mean-square-deviation (ca-r.m.s.d.). For ubiquitin, the computed set of conformations is a better representation of the observed 13C, chemical shifts in terms of the ca-r.m.s.d. than a single X-ray-derived structure. However, for the RNA-binding domain of nonstructural protein 1 of influenza A virus, consideration of an ensemble of conformations does not improve the agreement with the observed 13C, chemical shifts. Whether an ensemble of conformations rather than any single structure is a more accurate representation of a protein structure in the crystal as well as of the observed 13C, chemical shifts is determined by the dispersion of coordinates, in terms of the all-atom r.m.s.d. among the generated models; these generated models satisfy the experimental X-ray data with accuracy as good as the PDB structure. Therefore, generation of an ensemble is a necessary step to determine whether or not a single structure is sufficient for an accurate representation of both experimental X-ray data and observed 13C, chemical shifts in solution. [source] Determining the DUF55-domain structure of human thymocyte nuclear protein 1 from crystals partially twinned by tetartohedryACTA CRYSTALLOGRAPHICA SECTION D, Issue 3 2009Feng Yu Human thymocyte nuclear protein 1 contains a unique DUF55 domain consisting of 167 residues (55,221), but its cellular function remains unclear. Crystals of DUF55 belonged to the trigonal space group P31, but twinning caused the data to approach apparent 622 symmetry. Two data sets were collected to 2.3,Å resolution. Statistical analysis confirmed that both data sets were partially twinned by tetartohedry. Tetartohedral twin fractions were estimated. After the structure had been determined, only one twofold axis of rotational pseudosymmetry was found in the crystal structure. Using the DALI program, a YTH domain, which is a potential RNA-binding domain from human YTH-domain-containing protein 2, was identified as having the most similar three-dimensional fold to that of DUF55. It is thus implied that DUF55 might be a potential RNA-related domain. [source] Structure of NS1A effector domain from the influenza A/Udorn/72 virusACTA CRYSTALLOGRAPHICA SECTION D, Issue 1 2009Shuangluo Xia The nonstructural protein NS1A from influenza virus is a multifunctional virulence factor and a potent inhibitor of host immunity. It has two functional domains: an N-terminal 73-amino-acid RNA-binding domain and a C-terminal effector domain. Here, the crystallographic structure of the NS1A effector domain of influenza A/Udorn/72 virus is presented. Structure comparison with the NS1 effector domain from mouse-adapted influenza A/Puerto Rico/8/34 (PR8) virus strain reveals a similar monomer conformation but a different dimer interface. Further analysis and evaluation shows that the dimer interface observed in the structure of the PR8 NS1 effector domain is likely to be a crystallographic packing effect. A hypothetical model of the intact NS1 dimer is presented. [source] U1A RNA-binding domain at 1.8,Å resolutionACTA CRYSTALLOGRAPHICA SECTION D, Issue 8 2003Peter B. Rupert The human U1A RNA-binding domain (RBD1) adopts one of the most common protein folds, the RNA-recognition motif, and is a paradigm for understanding RNA,protein interactions. A 2.8,Å resolution structure of the unbound RBD1 has previously been determined [Nagai et al. (1990). Nature (London), 348, 515,520] and revealed a well defined ,/, core with disordered termini. Using a longer construct, a 1.8,Å resolution structure of the unbound domain was determined that reveals an ordered C-terminal helix. The presence of this helix is consistent with a solution structure of the free domain [Avis et al. (1996). J. Mol. Biol.257, 398,411]; however, in the solution structure the helix occludes the RNA-binding surface. In the present structure, the helix occupies a position similar to that seen in a 1.9,Å resolution RNA,RBD1 complex structure [Oubridge et al. (1994). Nature (London), 372, 432,438]. The crystals in this study were grown from 2.2,M sodium malonate. It is possible that the high salt concentration helps to orient the C-terminal helix in the RNA-bound conformation by strengthening hydrophobic interactions between the buried face of the helix and the ,/, core of the protein. Alternatively, the malonate (several molecules of which are bound in the vicinity of the RNA-binding surface) may mimic RNA. [source] IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domainFEBS JOURNAL, Issue 24 2006Gopal P. Patel Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5, untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nm and 5.9 nm, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3, end of the ARS. Results of our analysis suggest that both protein·protein and protein·RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA. [source] | ||||||||||