Home About us Contact
|
Home About us Contact | ||
|
|
||
Mer Oligonucleotide (mer + oligonucleotide)
Selected AbstractsPreparation of Nanogapped Gold Nanoparticle Array for DNA DetectionELECTROANALYSIS, Issue 4 2008Shiho Tokonami Abstract A novel DNA detection technique using a gold nanoparticle array film electrode has been reported here. The gold nanoparticles molecularly linked with binder molecule (1,10-decanedithiol) were separated 1.3,nm from each other, and the DNA conductivity change from single to double strand was measured by monitoring a voltage drop across the particles, between which a probe of a 12-mer oligonucleotide was immobilized. In adding a complementary oligonucleotide on the nanoparticle film chip, an immediate decrease in the film resistance (ca. 1.4 ,) due to a hybridization event occurred in a reproducible manner with this simple setup. In the paper, we have an interest in the primary sensing properties; effect of the film resistance on the sensor response, dependence of the resistance change on the DNA concentration, and the performance of the system for DNA detection including single nucleotide polymorphisms were described. [source] Two-Surface Strategy in Electrochemical DNA Hybridization Assays: Detection of Osmium-Labeled Target DNA at Carbon ElectrodesELECTROANALYSIS, Issue 5-6 2003Miroslav Fojta Abstract Target DNAs, including a 71-mer oligonucleotide, a PCR product and a plasmid DNA, all containing oligo(A) stretches, were hybridized at magnetic Dynabeads oligo(dT)25 (DBT). The hybridization events were detected using a technique based on chemical modification of the target DNA with a complex of osmium tetroxide with 2,2,-bipyridine (Os,,bipy) and voltammetric detection at carbon electrodes. DNA was modified with Os,,bipy prior to capture at DBT, at the beads, or after release from the beads. In the latter case, DNA-Os,,bipy was detected in the reaction mixture using adsorptive transfer stripping voltammetry involving extraction of unreacted Os,,bipy from the electrode by organic solvents. Pre-labeling of the target plasmid DNA and the PCR product with Os,,bipy significantly increased the yield of DNA captured at the beads. Tens of femtomoles of both short (the 71-mer oligonucleotide) and long (the 3-kilobase plasmid) target DNAs in a 20-microliter hybridization sample can be easily detected by means of these techniques. Various carbon electrode materials, including pyrolytic graphite (PGE), highly oriented pyrolytic graphite (HOPGE), carbon paste (CPE), glassy carbon and pencil graphite, were tested regarding their suitability for the detection of osmium-labeled DNA. Among them, PGE and HOPGE appeared usable in the measurements of both purified DNA-Os,,bipy and its mixtures with unreacted Os,,bipy while CPE was suitable for the detection purified osmium-labeled DNA. [source] Factors determining the performance of triple quadrupole, quadrupole ion trap and sector field mass spectrometer in electrospray ionization mass spectrometry.RAPID COMMUNICATIONS IN MASS SPECTROMETRY, Issue 13 2001The sequence coverage by fragment ions resulting from collision-induced dissociation in a triple stage quadrupole (TSQ) and a quadrupole ion trap (QIT) mass spectrometer of 10,20-mer oligonucleotides was investigated. While (a-B) and w ion series were the most abundant on both instruments, additional ion series of sequence relevance were preferably formed in the TSQ. Thus, a total number of 83 fragment ions were used to deduce the complete sequence of a 10-mer oligonucleotide of mixed sequence from a tandem mass spectrum recorded on the TSQ. The complete sequence was also encoded in the 28 fragments that were obtained from the QIT under comparable fragmentation conditions. Spectrum complexity increased considerably at the cost of signal-to-noise ratio upon fragmentation of a 20-mer oligonucleotide in the TSQ, whereas spectrum interpretation with longer oligonucleotides was significantly more straightforward in spectra recorded on the QIT. The extent of fragmentation had to be optimized by appropriate setting of collision energy and choice of precursor ion charge state in order to obtain full sequence coverage by fragments for de novo sequencing. Moreover, full sequence information was also dependent on base sequence because of the low tendency of backbone cleavage at thymidines. Tandem mass spectrometry on the QIT yielded redundant information that was successfully utilized to deduce the complete sequence of 20-mer oligonucleotides with high confidence. Copyright © 2001 John Wiley & Sons, Ltd. [source] HvMCB1, a R1MYB transcription factor from barley with antagonistic regulatory functions during seed development and germinationTHE PLANT JOURNAL, Issue 1 2006Ignacio Rubio-Somoza Summary The functional analysis of hydrolase gene promoters induced by gibberellin (GA) in barley aleurone cells upon germination has identified a tripartite GA-response complex (GARC) containing a 5,- TATCCAC-3, box as well as the GA-responsive element (GARE) recognized by GAMYB and the pyrimidine box interacting with the DOF transcription factors BPBF and SAD. We show here that the MCB1 gene encoding a R1MYB protein binds to the 5,- TATCCAC-3, (GATA core) box in vitro and is a transcriptional repressor of a GA-induced amylase (Amy6.4) promoter in bombarded aleurone layers. Northern blot and mRNA in situ hybridization analyses showed that the MCB1 transcripts accumulate in the aleurone cells upon germination, as well as in endosperm tissues during seed development. The HvMCB1 protein expressed in bacteria binds in a specific manner to a 27-mer oligonucleotide containing the 5,-TATCCAC-3, sequence, derived from the promoter region of the Amy6.4 gene. Accumulation of the MCB1 transcript diminished in response to external GA incubation in aleurone cells, and in transient expression experiments HvMCB1 repressed transcription of the Amy6.4 promoter in GA-treated aleurone layers and reversed the GAMYB-mediated activation of this amylase promoter. In contrast, during endosperm maturation HvMCB1 acted as a transcription activator of the seed-specific Itr1 gene promoter through binding to a 5,-GATAAGATA-3, box. [source] Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3,-terminusACTA CRYSTALLOGRAPHICA SECTION F (ELECTRONIC), Issue 5 2010Hyun Koo Yeo The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3,-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8,Å resolution. The oligonucleotide was crystallized at 277,K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34,Å, , = 91.37, , = 93.21, , = 92.35°. [source] Development of a consensus microarray method for identification of some highly pathogenic virusesJOURNAL OF MEDICAL VIROLOGY, Issue 11 2009Kang Xiao-Ping Abstract Some highly pathogenic viruses, such as Chikungunya virus, Japanese encephalitis virus, Yellow fever virus, Dengue virus, Hanta virus, SARS-CoV, and H5N1 avian influenza virus can cause severe infectious diseases. However, the consensus method for detecting these viruses has not been well established. A rapid and sensitive microarray approach for detection of these viruses and a panel of specific probes covering nine genera and 16 virus species were designed. 70-mer oligonucleotides were used at the genus level and 50-mer oligonucleotides were at the species level, respectively. To decrease the interference of the host genome in hybridization, the consensus genus primers were designed and used to reverse transcribe only virus genome. The synthesis of the second strand was carried out with a random primer sequence (5,-GTTTCCCAGTAGGTCTCNNNNNNNN-3,). The amplified products were labeled and processed for microarray analyses. This microarray-based method used the highly conserved consensus primers to synthesize specifically the virus cDNA and could identify effectively Chikungunya virus, Japanese encephalitis virus, Yellow fever virus, Dengue virus, Tick borne encephalitis virus, and H5N1 avian influenza virus. Using this method, one unknown virus isolated from pig brain in Shanxi Province, China was identified. This method may have an important potential application for the diagnosis of virus infection. J. Med. Virol. 81:1945,1950, 2009. © 2009 Wiley-Liss, Inc. [source] Factors determining the performance of triple quadrupole, quadrupole ion trap and sector field mass spectrometer in electrospray ionization mass spectrometry.RAPID COMMUNICATIONS IN MASS SPECTROMETRY, Issue 13 2001The sequence coverage by fragment ions resulting from collision-induced dissociation in a triple stage quadrupole (TSQ) and a quadrupole ion trap (QIT) mass spectrometer of 10,20-mer oligonucleotides was investigated. While (a-B) and w ion series were the most abundant on both instruments, additional ion series of sequence relevance were preferably formed in the TSQ. Thus, a total number of 83 fragment ions were used to deduce the complete sequence of a 10-mer oligonucleotide of mixed sequence from a tandem mass spectrum recorded on the TSQ. The complete sequence was also encoded in the 28 fragments that were obtained from the QIT under comparable fragmentation conditions. Spectrum complexity increased considerably at the cost of signal-to-noise ratio upon fragmentation of a 20-mer oligonucleotide in the TSQ, whereas spectrum interpretation with longer oligonucleotides was significantly more straightforward in spectra recorded on the QIT. The extent of fragmentation had to be optimized by appropriate setting of collision energy and choice of precursor ion charge state in order to obtain full sequence coverage by fragments for de novo sequencing. Moreover, full sequence information was also dependent on base sequence because of the low tendency of backbone cleavage at thymidines. Tandem mass spectrometry on the QIT yielded redundant information that was successfully utilized to deduce the complete sequence of 20-mer oligonucleotides with high confidence. Copyright © 2001 John Wiley & Sons, Ltd. [source] Structure,Activity Relationship Studies on the Immune Stimulatory Effects of Base-Modified CpG Toll-Like Receptor 9 AgonistsCHEMMEDCHEM, Issue 9 2006Marion Jurk Dr. Abstract Synthetic oligodeoxynucleotides containing unmethylated deoxycytidylyl-deoxyguanosine dinucleotide (CpG) motifs are able to stimulate potent immune responses through a signaling pathway involving Toll-like receptor 9 (TLR9). We have investigated the structure,activity relationship (SAR) of base-modified CpG oligonucleotides with TLR9 by measuring TLR9 activation by 20-mer oligonucleotides having just a single human recognition motif (5,-GTCGTT-3,) in functional cell-based TLR9 assays. Substitution of guanine by hypoxanthine and 6-thioguanine resulted in activity similar to the unmodified parent molecule, whereas purine, 2-aminopurine, 2,6-diaminopurine, and 8-oxo-7,8-dihydroguanine substitution resulted in approximately 40,60,% reduction in activity, and 7-deazaguanine substitution led to the strongest (80,%) reduction in TLR9 stimulation. Furthermore, none of the investigated modifications at C5 and N4 of cytosine were well tolerated with respect to human TLR9 stimulation. Our results are compatible with a SAR model in which guanine is recognized by the Hoogsteen site, and C5 is most critical for recognition of cytosine. In addition, we found significant species-specific differences between human and murine TLR9 recognition, which demonstrates the importance of choosing appropriate assay systems for SAR studies. [source] | |||||||||||||