Home About us Contact
|
Home About us Contact | ||
|
|
||
Markers Used (marker + used)
Selected AbstractsHaemoglobin Etobicoke, an incidental finding in an Irish diabeticINTERNATIONAL JOURNAL OF LABORATORY HEMATOLOGY, Issue 4 2003D. A. O'Brien Summary It is well recognized that haemoglobin variants can be detected during the measurement of HbA1c by high-performance liquid chromatography (HPLC). A number of variants have been reported as compromising the quantification of HbA1c, a marker used in the assessment of glycaemic control in diabetes. We describe a case of haemoglobin Etobicoke, a rare alpha chain variant detected in an Irish diabetic during HbA1c analysis. Its identity was confirmed using a series of investigations. These included haemoglobin electrophoresis at alkaline and acid pH, isoelectric focusing and globin chain electrophoresis. Ultimately mass spectrometry isolated the mutation at position alpha 84 (F5). Haemoglobin Etobicoke, first described in Canada in 1969 has not previously been detected on HbA1c analysis. In the presence of this rare variant, HbA1c, a standard method using HPLC to assess glycaemic control in diabetes is unreliable and alternatives such as fructosamine need to be considered. HbA1c measured by automated HPLC will effectively screen populations where haemoglobin variants were not previously known. Precise identity of these variants when they are detected is crucial to the reliable interpretation of HbA1c analyses. [source] Historical colonization and demography of the Mediterranean damselfish, Chromis chromisMOLECULAR ECOLOGY, Issue 13 2005VERA S. DOMINGUES Abstract The desiccation of the Mediterranean Sea during the Messinian Salinity Crisis 6.0,5.3 million years ago (Ma), caused a major extinction of the marine ichthyofauna of the Mediterranean. This was followed by an abrupt replenishment of the Mediterranean from the Atlantic after the opening of the Strait of Gibraltar. In this study, we combined demographic and phylogeographic approaches using mitochondrial and nuclear DNA markers to test the alternative hypotheses of where (Atlantic or Mediterranean) and when (before or after the Messinian Salinity Crisis) speciation occurred in the Mediterranean damselfish, Chromis chromis. The closely related geminate transisthmian pair Chromis multilineata and Chromis atrilobata was used as a way of obtaining an internally calibrated molecular clock. We estimated C. chromis speciation timing both by determining the time of divergence between C. chromis and its Atlantic sister species Chromis limbata (0.93,3.26 Ma depending on the molecular marker used, e.g. 1.23,1.39 Ma for the control region), and by determining the time of coalescence for C. chromis based on mitochondrial control region sequences (0.14,0.21 Ma). The time of speciation of C. chromis was always posterior to the replenishment of the Mediterranean basin, after the Messinian Salinity Crisis. Within the Mediterranean, C. chromis population structure and demographic characteristics revealed a genetic break at the Peloponnese, Greece, with directional and eastbound gene flow between western and eastern groups. The eastern group was found to be more recent and with a faster growing population (coalescent time = 0.09,0.13 Ma, growth = 485.3) than the western group (coalescent time = 0.13,0.20 Ma, growth = 325.6). Our data thus suggested a western origin of C. chromis, most likely within the Mediterranean. Low sea water levels during the glacial periods, the hydrographic regime of the Mediterranean and dispersal restriction during the short pelagic larval phase of C. chromis (18,19 days) have probably played an important role in C. chromis historical colonization. [source] Re-encountering Cuban Tastes in Australia,THE AUSTRALIAN JOURNAL OF ANTHROPOLOGY, Issue 1 2004Euridice T. Charon Cardona This paper explores the challenges presented to the everyday praxis of maintaining Cuban identity in the Australian context through an examination of the preparation and eating of Cuban food by migrants in Sydney. I argue that the very different demographic configuration of Cubans in Australia and the US is played out through the different experiences of eating. Cuban identity in the US contrasts markedly with the situation in NSW where the small population of Cubans focus on maintaining a Cuban world in their domestic space through the practice of eating Cuban food, rather than in the public domain. The struggle to find and prepare Cuban food in Australia reflects a distance and separation from homeland both spatially and temporally. The paper suggests that the eating habits of this group constitute a significant ethnic marker used by members of the group to differentiate themselves as Cubans in Australia. Additionally, I argue that the existence of a substantial multicultural and ethnic food market in Australia allows Cuban migrants to acquire the products needed for the Cuban cuisine, from shops primarily serving numerically larger ethnic groups. [source] Ethnicity affects the diagnostic validity of alpha-fetoprotein in hepatocellular carcinomaASIA-PACIFIC JOURNAL OF CLINICAL ONCOLOGY, Issue 2-3 2005Amal GAD Abstract Introduction: Hepatocellular carcinoma (HCC) is the fourth most common cancer worldwide with a high morbidity and mortality. Alpha-fetoprotein (AFP) is considered the main tumor marker for HCC diagnosis, but the variation in its diagnostic validity among studies justifies further investigation of the underlying contributing factors. Ethnic difference could be one of the factors that has not been well studied. We aimed at investigating the ethnic difference in AFP validity between Egyptian (representing Arabic North African) and Japanese (representing Asian) for HCC diagnosis. Methods: Four cohorts with chronic liver diseases (CLD) were studied: 171 Egyptian (65 HCC/106 non-HCC), and 173 Japanese (45 HCC/128 non-HCC). Laboratory tests including serum AFP, protein-induced vitamin K deficiency or absence (PIVKA-II), alanine aminotransferase (ALT), total bilirubin, platelet count, HBsAg, anti-HCV, and HCV core antigen were conducted using standard commercially available assays. Results: A significantly higher sensitivity of AFP in Egyptian in comparison with Japanese for HCC diagnosis (99 vs 67%, P < 0.001) was observed using an AFP cut-off point of 10 ng/mL, with a comparable specificity, (75,vs, 82%), While, a, sensitivity, of, 98, versus, 56%,,P < 0.001, and, a, specificity, of, 83, versus, 89% was found for AFP cut-off point of 20 ng/mL, respectively. The area under the receiver operating characteristic curve (ROC) was found to be 0.98 (95%CI = 0.969,0.997) for Egyptian and 0.77 (95%CI = 0.686,0.864) for Japanese. The highest sensitivity for the former group occurred at AFP = 20.5 ng/mL and at AFP = 10.2 ng/mL for the latter. Univariate analysis showed no effect for age, sex, underlying liver disease, cirrhosis, Child's class or tumor characteristics (size, pathological grade) on AFP sensitivity, while race significantly contributed to the higher sensitivity among Egyptians in comparison with the Japanese. Using ROC analysis, the AFP cut-off point for HCC detection in each subgroup of patients with and without each of the risk factors of interest was determined and the subgroups were again subclassified according to AFP positivity (< or , the decided cut-off point for each group). Logistic regression analysis of those factors combined showed that Egyptian ethnicity with an AFP level >20.5 ng/mL (P = 0.007), older age (>50 years) with an AFP level >26 ng/mL (P = 0.010), and cirrhosis with an AFP level >10.5 ng/mL (P = 0.014) were the independent risk factors for HCC. Conclusion: There is an ethnic variation in AFP validity between Egyptian and Japanese patients with a significantly lower sensitivity in the latter. Alpha-fetoprotein should not be the only marker used for screening HCC among Asian Japanese and younger age groups (<50 years) with CLD. In addition, an AFP cut-off point of 20 ng/mL is recommended when screening patients of Asian origin for HCC. [source] 2332: Pathological changes of anatomical structure and markers of limbal stem cell niche due to inflammationACTA OPHTHALMOLOGICA, Issue 2010C CURCIO Purpose It's known that severe inflammatory processes may cause limbal stem cell (SC) deficiency decreasing the number of SC niches and changing the microanatomy of these structures. Methods The aim of this study was to evaluate the expression of different SC markers in normal human limbus and to study how an inflammatory conditions can modulate these antigens. To understand the pathological changes in limbal crypts structure due to severe inflammation, a case of corneal melting and perforation in advanced herpes simplex (HSV) disease, two cases of endophthalmitis and a case of fungal infection were analyzed.Samples were examined by immunohistochemistry or immunofluorescence for p63, vimentin, laminin5, integrin (Int) ,6, int ,1, int ,4, ABCG2, desmoglein 3, connexin43, N-cadherin and cytokeratin (K) 12 positivity. We evaluated the anatomical structure of limbal crypts in each case and the positivity for SC marker used to identify SC. Results In normal limbus, the investigated SC markers were positive. In the HSV we didn't observe presence of crypts, whereas in both cases of endophthalmitis crypts were still present but they had an atypical structure: the basal cells in the crypts were "stretched" and endowed by inflammatory cells. In the pathological cases, we observed positivity for K12 while, among SC markers, p63, ABCG2 and connexin43 were still present; the others antigens were variably expressed. Conclusion Different pathologies involving the limbus may result in marked chenges of expression of SC markers within the crypts. [source] Modulation of antigen expression in B-cell precursor acute lymphoblastic leukemia during induction therapy is partly transient: Evidence for a drug-induced regulatory phenomenon.CYTOMETRY, Issue 3 2010Results of the AIEOP-BFM-ALL-FLOW-MRD-Study Group Abstract Background: Changes of antigen expression on residual blast cells of acute lymphoblastic leukemia (ALL) occur during induction treatment. Many markers used for phenotyping and minimal residual disease (MRD) monitoring are affected. Glucocorticoid (GC)-induced expression modulation has been causally suspected, however, subclone selection may also cause the phenomenon. Methods: We investigated this by following the phenotypic evolution of leukemic cells with flow cytometry from diagnosis to four time points during and after GC containing chemotherapy in the 20 (of 360 consecutive) B-cell precursor patients with ALL who had persistent MRD throughout. Results: The early expression changes of CD10 and CD34 were reversible after stop of GC containing chemotherapy. Modulation of CD20 and CD45 occurred mostly during the GC phase, whereas CD11a also changed later on. Blast cells at diagnosis falling into gates designed according to "shifted" phenotypes from follow-up did not form clusters and were frequently less numerous than later on. Conclusions: Our data support the idea that drug-induced modulation rather than selection causes the phenomenon. The good message for MRD assessment is that modulation is transient in at least two (CD10 and CD34) of the five prominent antigens investigated and reverts to initial aberrant patterns after stop of GC therapy, whereas CD20 expression gains new aberrations exploitable for MRD detection. © 2010 Clinical Cytometry Society [source] LOCAL HETEROZYGOSITY-FITNESS CORRELATIONS WITH GLOBAL POSITIVE EFFECTS ON FITNESS IN THREESPINE STICKLEBACKEVOLUTION, Issue 8 2006Mélissa Lieutenant-Gosselin Abstract The complex interactions between genetic diversity and evolution have important implications in many biological areas including conservation, speciation, and mate choice. A common way to study these interactions is to look at heterozygosity-fitness correlations (HFCs). Until recently, HFCs based on noncoding markers were believed to result primarily from global inbreeding effects. However, accumulating theoretical and empirical evidence shows that HFCs may often result from genes being linked to the markers used (local effect). Moreover, local effect HFCs could differ from global inbreeding effects in their direction and occurrence. Consequently, the investigation of the structure and consequences of local HFCs is emerging as a new important goal in evolutionary biology. In this study of a wild threespine stickleback (Gasterosteus aculeatus) population, we first tested the presence of significant positive or negative local effects of heterozygosity at 30 microsatellites loci on five fitness components: survival, mating success, territoriality, length, and body condition. Then, we evaluated the direction and shape of total impact of local HFCs, and estimated the magnitude of the impacts on fitness using regression coefficients and selection differentials. We found that multilocus heterozygosity was not a reliable estimator of individual inbreeding coefficient, which supported the relevance of single-locus based analyses. Highly significant and temporally stable local HFCs were observed. These were mainly positive, but negative effects of heterozygosity were also found. Strong and opposite effects of heterozygosity are probably present in many populations, but may be blurred in HFC analyses looking for global effects only. In this population, both negative and positive HFCs are apparently driving mate preference by females, which is likely to contribute to the maintenance of both additive and nonadditive genetic variance. [source] The distribution of microsatellites in the Nasonia parasitoid wasp genomeINSECT MOLECULAR BIOLOGY, Issue 2010B. A. Pannebakker Abstract Microsatellites are important molecular markers used in numerous genetic contexts. Despite this widespread use, the evolutionary processes governing microsatellite distribution and diversity remain controversial. Here, we present results on the distribution of microsatellites of three species in the parasitic wasp genus Nasonia generated by an in silico data-mining approach. Our results show that the overall microsatellite density in Nasonia is comparable to that of the honey bee, but much higher than in eight non-Hymenopteran arthropods. Across the Nasonia vitripennis genome, microsatellite density varied both within and amongst chromosomes. In contrast to other taxa, dinucleotides are the most abundant repeat type in all four species of Hymenoptera studied. Whether the differences between the Hymenoptera and other taxa are of functional significance remains to be determined. [source] Comparison of phenotypic and genotypic markers for characterization of an outbreak of Salmonella serotype Havana in captive raptorsJOURNAL OF APPLIED MICROBIOLOGY, Issue 1 2003M.P. Reche Abstract Aims: To establish a typing method for tracing the epidemic relationship of 16 strains of Salmonella serotype Havana isolated from captive raptors showing no symptomatology and residing in a wildlife hospital in Spain. Methods and Results: Antimicrobial susceptibility testing, ribotyping, pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) methodology were applied. Ten unrelated strains of serotype Havana were included as a control group to provide a basis of for the efficiency of the different markers used. All outbreak-related strains were resistant to nalidixic acid and streptomycin and showed the same ripotype, pulsotype and AFLP pattern. Conclusions: This is the first time that AFLP analysis has been tested with serotype Havana isolates and it has demonstrated to be the most useful epidemiological tool for discriminating between unrelated and outbreak-related strains of this serotype. The results obtained suggest that all the Salmonella serotype Havana isolates represented a common outbreak strain whose origin of contamination could not be established although it is thought that it was the poultry meat used for raptors'diet. Significance and Impact of the Study: Our study suggests the importance of microbiological analysis of these products in order to prevent contamination and dissemination of Salmonellae in this kind of Hospital. [source] Cell resilience in species life spans: a link to inflammation?AGING CELL, Issue 4 2010Caleb E. Finch Summary Species differences in life span have been attributed to cellular survival during various stressors, designated here as ,cell resilience'. In primary fibroblast cultures, cell resilience during exposure to free radicals, hypoglycemia, hyperthermia, and various toxins has shown generally consistent correlations with the species characteristic life spans of birds and mammals. However, the mechanistic links of cell resilience in fibroblast cultures to different species life spans are poorly understood. We propose that certain experimental stressors are relevant to somatic damage in vivo during inflammatory responses of innate immunity, particularly, resistance to reactive oxygen species (ROS), low glucose, and hyperthermia. According to this hypothesis, somatic cell resilience determines species differences in longevity during repeated infections and traumatic injuries in the natural environment. Infections and injury expose local fibroblasts and other cells to ROS generated by macrophages and to local temperature elevations. Systemically, acute phase immune reactions cause hypoglycemia and hyperthermia. We propose that cell resilience to somatic stressors incurred in inflammation is important in the evolution of longevity and that longer-lived species are specifically more resistant to immune-related stressors. This hypothesis further specifies Kirkwood's disposable soma theory. We suggest expanding the battery of stressors and markers used for comparative studies to additional cell types and additional parameters relevant to host defense and to their ecological specificities. [source] URP-based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of WheatJOURNAL OF PHYTOPATHOLOGY, Issue 4 2010Rashmi Aggarwal Abstract Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs') are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5,GTGTGCGATCAGTTGCTGGG3,) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. [source] Do marker-based paternity assignments favour heterozygous and unrelated males?MOLECULAR ECOLOGY, Issue 9 2010JINLIANG WANG Abstract Genetic marker-based parentage analyses are widely applied to studies of natural populations in the fields of evolutionary biology, conservation biology and ecology. When the same markers used in a parentage analysis are used together with the inferred parentage in a downstream analysis, such as the analysis of mate choice in terms of heterozygosity or relatedness, a bias may be incurred because a subset of the genotypes are favoured in parentage assignments or non-exclusions. A previous simulation study shows that exclusion-based paternity analyses are biased in favour of heterozygous males, and males less related to the mothers than expected under random mating. In this study, I investigated the biases of genetic paternity analyses achieved by both exclusion- and likelihood-based methods, using both analytical and simulation approaches. It is concluded that while both exclusion- and likelihood-based methods can lead to biased paternity assignments or non-exclusions in favour of a subset of genotypes, the bias is not consistently towards heterozygous males or males apparently less related to mothers. Both the direction and extent of the bias depend heavily on the allele frequency distribution and the number of markers, the methods used for paternity assignments, and the estimators of relatedness. There exist important differences in the patterns of the biases between exclusion- and likelihood-based paternity analysis methods. It is concluded that the markers, except when they are highly informative to yield accurate paternity assignments or exclusions, should be split into two subsets which are used separately in the paternity and downstream analyses. [source] Genetic variability is unrelated to growth and parasite infestation in natural populations of the European eel (Anguilla anguilla)MOLECULAR ECOLOGY, Issue 22 2009J. M. PUJOLAR Abstract Positive correlations between individual genetic heterozygosity and fitness-related traits (HFCs) have been observed in organisms as diverse as plants, marine bivalves, fish or mammals. HFCs are not universal and the strength and stability of HFCs seem to be variable across species, populations and ages. We analysed the relationship between individual genetic variability and two different estimators of fitness in natural samples of European eel, growth rate (using back-calculated length-at-age 1, 2 and 3) and parasite infestation by the swimbladder nematode Anguillicola crassus. Despite using a large data set of 22 expressed sequence tags-derived microsatellite loci and a large sample size of 346 individuals, no heterozygote advantage was observed in terms of growth rate or parasite load. The lack of association was evidenced by (i) nonsignificant global HFCs, (ii) a Multivariate General Linear Model showing no effect of heterozygosity on fitness components, (iii) single-locus analysis showing a lower number of significant tests than the expected false discovery rate, (iv) sign tests showing only a significant departure from expectations at one component, and, (v) a random distribution of significant single-locus HFCs that was not consistent across fitness components or sampling sites. This contrasts with the positive association observed in farmed eels in a previous study using allozymes, which can be explained by the nature of the markers used, with the allozyme study including many loci involved in metabolic energy pathways, while the expressed sequence tags-linked microsatellites might be located in genes or in the proximity of genes uncoupled with metabolism/growth. [source] Twenty years of phylogeography: the state of the field and the challenges for the Southern HemisphereMOLECULAR ECOLOGY, Issue 17 2008LUCIANO B. BEHEREGARAY Abstract Phylogeography is a young, vigorous and integrative field of study that uses genetic data to understand the history of populations. This field has recently expanded into many areas of biology and also into several historical disciplines of Earth sciences. In this review, I present a numerical synthesis of the phylogeography literature based on an examination of over 3000 articles published during the first 20 years of the field (i.e. from 1987 to 2006). Information from several topics needed to evaluate the progress, tendencies and deficiencies of the field is summarized for 10 major groups of organisms and at a global scale. The topics include the geography of phylogeographic surveys, comparative nature of studies, temporal scales and major environments investigated, and genetic markers used. I also identify disparities in research productivity between the developing and the developed world, and propose ways to reduce some of the challenges faced by phylogeographers from less affluent countries. Phylogeography has experienced explosive growth in recent years fuelled by developments in DNA technology, theory and statistical analysis. I argue that the intellectual maturation of the field will eventually depend not only on these recent developments, but also on syntheses of comparative information across different regions of the globe. For this to become a reality, many empirical phylogeographic surveys in regions of the Southern Hemisphere (and in developing countries of the Northern Hemisphere) are needed. I expect the information and views presented here will assist in promoting international collaborative work in phylogeography and in guiding research efforts at both regional and global levels. [source] How to track and assess genotyping errors in population genetics studiesMOLECULAR ECOLOGY, Issue 11 2004A. BONIN Abstract Genotyping errors occur when the genotype determined after molecular analysis does not correspond to the real genotype of the individual under consideration. Virtually every genetic data set includes some erroneous genotypes, but genotyping errors remain a taboo subject in population genetics, even though they might greatly bias the final conclusions, especially for studies based on individual identification. Here, we consider four case studies representing a large variety of population genetics investigations differing in their sampling strategies (noninvasive or traditional), in the type of organism studied (plant or animal) and the molecular markers used [microsatellites or amplified fragment length polymorphisms (AFLPs)]. In these data sets, the estimated genotyping error rate ranges from 0.8% for microsatellite loci from bear tissues to 2.6% for AFLP loci from dwarf birch leaves. Main sources of errors were allelic dropouts for microsatellites and differences in peak intensities for AFLPs, but in both cases human factors were non-negligible error generators. Therefore, tracking genotyping errors and identifying their causes are necessary to clean up the data sets and validate the final results according to the precision required. In addition, we propose the outline of a protocol designed to limit and quantify genotyping errors at each step of the genotyping process. In particular, we recommend (i) several efficient precautions to prevent contaminations and technical artefacts; (ii) systematic use of blind samples and automation; (iii) experience and rigor for laboratory work and scoring; and (iv) systematic reporting of the error rate in population genetics studies. [source] Associations among cytoplasmic molecular markers, gender, and components of fitness in Silene vulgaris, a gynodioecious plantMOLECULAR ECOLOGY, Issue 3 2003D. E. Mccauley Abstract It has been suggested that the dynamics of chloroplast DNA (cpDNA) or mitochondrial DNA (mtDNA) genetic markers used in studies of plant populations could be influenced by natural selection acting elsewhere in the genome. This could be particularly true in gynodioecious plants if cpDNA or mtDNA genetic markers are in gametic disequilibrium with genes responsible for sex expression. In order to investigate this possibility, a natural population of the gynodioecious plant Silene vulgaris was used to study associations among mtDNA haplotype, cpDNA haplotype, sex and some components of fitness through seed. Individuals were sampled for mtDNA and cpDNA haplotype as determined using restriction fragment length polymorphism (RFLP) methods, sex (female or hermaphrodite), fruit number, fruit set, seeds/fruit and seed germination. The sex of surviving germinating seeds was also noted. All individuals in the population fell into one of two cytoplasmic categories, designated haplotypes f and g by a unique electrophoretic signature in both the mtDNA and cpDNA. The subset of the population carrying haplotype g included a significantly higher proportion of females when compared with the sex ratio of the subset carrying the f haplotype. Haplotype g had a significantly higher fitness when measured by fruit number, fruit set and seeds/fruit, whereas haplotype f had significantly higher fitness when measured by seed germination. Offspring of individuals carrying haplotype g included a significantly greater proportion of females when compared with offspring of individuals carrying the f haplotype. Other studies of gynodioecious plants have shown that females generally have higher fitness through seed than hermaphrodites, but in this study not all fitness differences between haplotypes could be predicted from differences in haplotype-specific sex ratio alone. Rather, some differences in haplotype-specific fitness were due to differences in fitness between individuals of the same sex, but carrying different haplotypes. The results are discussed with regard to the potential for hitchhiking selection to influence the dynamics of the noncoding regions used to designate the cpDNA and mtDNA haplotypes. [source] Spatial autocorrelation and linkage of Mendelian RAPD markers in a population of Picea abies KarstMOLECULAR ECOLOGY, Issue 3 2002Gabriele Bucci Abstract The spatial clustering of single- and di-locus genotypes in a natural, continuous population of Norway spruce was investigated using 69 Mendelian Random Amplified Polymorphic DNA (RAPD) markers that covered about 15% of the species' genome, and whose linkage relationships were known. Spatial autocorrelation techniques and randomization tests, applied to both single- and di-locus genotypes, revealed a weak, though significant, spatial structure at the scale 0,200 m (5% of single-locus and 7% of di-locus genotypes). To assess the relative importance of isolation by distance and linkage between markers on their spatial genetic structuring, we grouped joins between sampled trees into ,equivalence categories' expected to show similar, specific patterns of spatial distribution under isolation by distance. Results from both single- and di-locus analyses were consistent with the existence of patches of like homozygotes (about 8% and 11% of loci at the single- and di-locus level, respectively) surrounded by a mix of like heterozygotes. Similar structuring has been predicted by simulation models under isolation by distance and selective neutrality. Overall, linkage between markers accounted for an increase of spatial clumping of di-locus genotypes involving tightly linked loci with recombination fractions up to 0.1, a consequence of limited, stochastic spread of single-locus genotypes in space. Our results support the hypothesis that isolation by distance and linkage have a small, though significant, effect even within continuous forest tree populations. In general, the spatial distribution of multilocus genotypes within populations should be interpreted with caution when linkage relationships among the markers used are unknown. [source] Development of simple sequence repeat (SSR) markers and their use in identification of Dendrobium varietiesMOLECULAR ECOLOGY RESOURCES, Issue 3 2006G. H. YUE Abstract The aim of this study was to develop simple sequence repeat (SSR) markers for Dendrobium varieties/species, many of which have medicinal and horticultural values. Two genomic DNA libraries of Dendrobium Sonia enriched with GA repeats and CA repeats were constructed. Fourteen polymorphic SSR markers were identified when screened against 42 popular commercial Dendrobium hybrids. The average allele number was 12.0 ± 1.9 and the observed heterozyosity was averaged at 0.70. All 42 hybrids tested, except for two tissue culture mutants, were uniquely identified with the markers used. Sibling hybrids were closely clustered. Hybrids were also closer to parents. These SSR markers can be used for molecular ecology research, genetic mapping and marker-assisted breeding. They can also help protection for new Dendrobium varieties. [source] Maximum likelihood estimates of admixture in northeastern Mexico using 13 short tandem repeat lociAMERICAN JOURNAL OF HUMAN BIOLOGY, Issue 4 2002Ricardo M. Cerda-Flores Tetrameric short tandem repeat (STR) polymorphisms are widely used in population genetics, molecular evolution, gene mapping and linkage analysis, paternity tests, forensic analysis, and medical applications. This article provides allelic distributions of the STR loci D3S1358, vWA, FGA, D8S1179, D21S11, D18S51, D5S818, D13S317, D7S820, CSF1PO, TPOX, TH01, and D16S539 in 143 Mestizos from Northeastern Mexico, estimates of contributions of genes of European (Spanish), American Indian and African origin in the gene pool of this admixed Mestizo population (using 10 of these loci); and a comparison of the genetic admixture of this population with the previously reported two polymorphic molecular markers, D1S80 and HLA-DQA1 (n = 103). Genotype distributions were in agreement with Hardy-Weinberg expectations (HWE) for almost all 13 STR markers. Maximum likelihood estimates of admixture components yield a trihybrid model with Spanish, Amerindian, and African ancestry with the admixture proportions: 54.99% ± 3.44, 39.99% ± 2.57, and 5.02% ± 2.82, respectively. These estimates were not significantly different from those obtained using D1S80 and HLA-DQA1 loci (59.99% ± 5.94, 36.99% ± 5.04, and 3.02% ± 2.76). In conclusion, Mestizos of Northeastern Mexico showed a similar ancestral contribution independent of the markers used for evolutionary purposes. Further validation of this database supports the use of the 13 STR loci along with D1S80 and HLA-DQA1 as a battery of efficient DNA forensic markers in Northeastern Mestizo populations of Mexico. Am. J. Hum. Biol. 14:429,439, 2002. © 2002 Wiley-Liss, Inc. [source] Development and variability analysis of microsatellite markers in peachPLANT BREEDING, Issue 1 2002M. J. Aranzana Abstract A genomic DNA library enriched with AG/CT repeats has been developed from the peach cultivar ,Merrill O'Henry'. The enrichment method was efficient, with 61% of the clones obtained carrying a microsatellite sequence and a yield of one polymorphic microsatellite every 2.17 sequenced clones. From 35 microsatellites detected, 24 were polymorphic in a set of 25 cultivars including 14 peaches and 11 nectarines. A total of 82 alleles were found with the polymorphic microsatellites, with an average of a 37% of observed heterozygosity. Microsatellites with a high number of repeats were generally those having the largest number of alleles. All cultivars except two (,Spring Lady' and ,Queencrest') could be individually distinguished with the markers used. Just three selected microsatellites were enough for the discrimination of 24 out of the 25 possible genotypes. Cluster analysis grouped all nectarines in a single cluster. Peaches, with 75 of the 82 alleles found, were more variable than nectarines, with only 64. Microsatellites appear to be powerful and suitable markers for application in peach genetics and breeding. [source] Prediction of adverse pregnancy outcomes by combinations of first and second trimester biochemistry markers used in the routine prenatal screening of Down syndromePRENATAL DIAGNOSIS, Issue 5 2010Tianhua Huang Abstract Objective To investigate the associations between four defined adverse pregnancy outcomes and levels of first and second trimester maternal serum markers focusing in particular on how well combinations of markers predict these adverse outcomes. Methods This was a retrospective review of associations between first and second trimester serum markers and adverse pregnancy outcomes among 141 698 women who underwent prenatal screening for Down syndrome in Ontario, Canada. Detection rates (DR), false positive rates (FPR), and odds ratios were estimated using both single and combinations of markers for the adverse outcomes defined. Results Women with decreased second trimester unconjugated oestriol (uE3), deceased first trimester maternal serum pregnancy-associated plasma protein A (PAPP-A), increased second trimester serum alpha fetoprotein (AFP), or increased second trimester total human chorionic gonadotrophin (hCG) were at greater risk of developing adverse pregnancy outcomes. At a 5% FPR, combinations of these markers predicted at best 33.3% of fetal loss and 31.5% of preterm births (PTB) before 32 weeks of gestation. Conclusion There are significant associations between the levels of first and second trimester serum markers and adverse obstetric outcomes. However, even combinations of these markers can only predict adverse obstetric outcomes with modest accuracy. Copyright © 2010 John Wiley & Sons, Ltd. [source] The consanguinity effect on QF-PCR diagnosis of autosomal anomaliesPRENATAL DIAGNOSIS, Issue 5 2006Michel B. Choueiri Abstract Objectives Quantitative Fluorescent PCR (QF-PCR) is a simpler and faster method of detecting common chromosomal abnormalities when compared to cytogenetic analysis. The aim of our study is to investigate the applicability of this methodology in a population where consanguineous marriages are common and to estimate the heterozygous frequency of the PCR markers used. Methods Four hundred and twenty-three DNA samples were extracted from uncultured amniocytes and amplified with 18 short tandem repeats (STR) markers specific to chromosomes 13, 18 and 21. Amplification products were analyzed using the GeneScan software. Results QF-PCR correctly identified all the numerical abnormalities related to chromosomes 13, 18 and 21. A total of 24 autosomal trisomies (5.7%) were detected. The markers D21S1432 and D21S11 were the most consistent in providing unequivocal positive results for chromosome 21 and the heterozygosity percentages of the markers used were lower than the values reported in Western populations. Conclusion QF-PCR is reliable for the prenatal diagnosis of numerical anomalies of the chromosomes 13, 18 and 21 in our study population. The absence of STR heterozygosity data from Lebanon and surrounding countries makes our study very useful for the development of a reliable QF-PCR trisomy detection test. Copyright © 2006 John Wiley & Sons, Ltd. [source] First and second-trimester biochemical markers of chromosomal anomalies and their relationship to maternal haemoglobin levelsPRENATAL DIAGNOSIS, Issue 8 2005N. J. Cowans Abstract Objective To evaluate a previous hypothesis that maternal serum biochemical markers used in the assessment of Down syndrome risk are related to maternal haemoglobin concentrations. Methods A series of 1306 second-trimester prenatal screening records were retrieved including information on marker levels (AFP and f,hCG MoMs), Down's risk, a priori age risk, maternal weight and maternal height. Each individual record was merged with data from haematological investigations on samples collected on the same day. A similar series of 1688 first-trimester screening records were also retrieved including the maker levels for PAPP-A, and f,hCG MoMs were merged with data from haematological investigations carried out on the same day. The two groups were categorised according to their haemoglobin levels; anaemic (less than 11.0 g/dL in first trimester and 10.5 g/dL in the second trimester), high haemoglobin (greater than 14.0 g/dL and 13.2 g/dL) or normal (between these ranges). An analysis was made of marker levels in the various groups before and after correction for ethnicity and of the screen-positive rate in the various groups. Using a formula based on maternal height and weight, variation of marker levels with plasma volume was assessed. Results In the first trimester, 12.6% of the pregnant population was anaemic and 1.6% had elevated haemoglobin levels. In the second trimester this was 12.7 and 3.9%. These figures varied considerably with ethnic origin, with Asian and Afro-Caribbean women being more anaemic than Caucasian women. Haemoglobin levels declined by 7% between the 11- and 21-week period. Maternal plasma volume (as calculated by a widely used maternal height and weight relationship) was not correlated with weight-corrected biochemical marker MoMs in either trimester. A weak but significant correlation of maternal plasma volume and haemoglobin concentration was observed. There was no significant correlation between biochemical marker MoMs and haemoglobin concentration. Although the proportion of pregnancies designated screen positive decreased as haemoglobin levels increased, this was paralleled by a decrease in the maternal age apriori risk. Conclusions There is no relationship between maternal haemoglobin levels and the levels of Down syndrome markers in either the first or second trimester. Biochemical marker levels do not need to be corrected for haemoglobin concentrations when used in screening for Down syndrome. Copyright © 2005 John Wiley & Sons, Ltd. [source] Asymmetry of the os pubis: Implications for the Suchey-Brooks methodAMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY, Issue 2 2009Rebecca S. Overbury Abstract Studies of skeletal development frequently document populational incidences of bilateral asymmetry. Degenerative morphological skeletal changes, attributed to age related and irregular ossification, may also progress asymmetrically, either as the result of asymmetric biomechanical factors expressed over the lifespan, asymmetric expression of physiological processes, or progressive magnification of asymmetry acquired previously during development. This study illustrates the effects of bilateral asymmetry on age at death estimates obtained from human skeletal remains. The Suchey-Brooks method, which uses the pubic symphyseal face for age estimation (Katz and Suchey, Am J Phys Anthropol 69 1986 427,435), was selected for the study based on its widespread use. Asymmetry in the Suchey-Brooks symphyseal age phases was found in over 60% of a sample composed of 20th century White male individuals from 18 to 86 years of age (N = 130). However, results suggest that the presence of asymmetry does not compromise the accuracy of the Suchey-Brooks method if the morphologically older symphyseal face of an asymmetric individual is used to estimate age at death. In addition, weak directional asymmetry and a correlation between age and asymmetry were found. This suggests that a comparison of asymmetry in this area with that in other skeletal areas, where the factors originating and influencing asymmetry are better understood, may be useful in better understanding the biological processes which underlie the age markers used in the Suchey-Brooks method. Am J Phys Anthropol 2009. © 2009 Wiley-Liss, Inc. [source] Fine mapping of quantitative trait loci for mastitis resistance on bovine chromosome 11ANIMAL GENETICS, Issue 4 2009N. F. Schulman Summary Quantitative trait loci (QTL) affecting clinical mastitis (CM) and somatic cell score (SCS) were mapped on bovine chromosome 11. The mapping population consisted of 14 grandsire families belonging to three Nordic red cattle breeds: Finnish Ayrshire (FA), Swedish Red and White (SRB) and Danish Red. The families had previously been shown to segregate for udder health QTL. A total of 524 progeny tested bulls were included in the analysis. A linkage map including 33 microsatellite and five SNP markers was constructed. We performed combined linkage disequilibrium and linkage analysis (LDLA) using the whole data set. Further analyses were performed for FA and SRB separately to study the origin of the identified QTL/haplotype and to examine if it was common in both populations. Finally, different two-trait models were fitted. These postulated either a pleiotropic QTL affecting both traits; two linked QTL, each affecting one trait; or one QTL affecting a single trait. A QTL affecting CM was fine-mapped. In FA, a haplotype having a strong association with a high negative effect on mastitis resistance was identified. The mapping precision of an earlier detected SCS-QTL was not improved by the LDLA analysis because of lack of linkage disequilibrium between the markers used and the QTL in the region. [source] Front and Back Covers, Volume 25, Number 5.ANTHROPOLOGY TODAY, Issue 5 2009October 200 Front and back cover caption, volume 25 issue 5 FIELDWORK AND TECHNOLOGY The images on the front and back covers illustrate two of several reflections in this issue on the impacts of technology on the world studied by anthropologists. On the front cover, an internet cafe is one of the first sights to greet visitors to Dhunche, once a ,remote' area in northern Nepal. On the back cover, a youth tries out a telescope during the commemoration of the confirmation of Einstein's General Theory of Relativity at Roça Sundy, Príncipe, where Arthur Eddington observed a total solar eclipse. In his editorial, Bob Simpson remarks on how much the craft of fieldwork has changed as a result of the widespread on-site availability of communications technology, placing even the remotest sites within reach of home or employer. In this post-Malinowskian fieldwork, where the distinction between back here and out there has disappeared, what are the implications of this for our craft and for the quality of our obversations? Gisa Weszkalnys reflects on her fieldwork site of Príncipe as the location of one of the most important events in 20th-century science, the confirmation of Einstein's General Theory of Relativity. She overlays the 2009 commemoration of this event, with international institutions promoting scientific knowledge and tourism, with another, colonial history of Príncipe as the focus of a controversy around the alleged use of slave labour in its cocoa plantations. As Kristín Loftsdóttir argues in her article, science and technology are among a range of markers used to determine who is most in need of international development, thus contributing to what she calls the ,racialization of development'. Akbar Ahmed alerts us to the fear in Washington, DC and Islamabad that the Taliban, who have recently taken over his field site in Swat Province, could potentially destabilize world order by appropriating nuclear technology. There are evidently many ways in which science and technology can and do affect our field sites. One of the greatest challenges for anthropology will be to experiment creatively and innovate with appropriate technologies in partnership. In this way we can generate more egalitarian conversations in an atmosphere of mutual respect, trust and tolerance. Whatever fieldwork becomes, it must be founded on such engagement with the broadest of publics, while making the most of these new technologies. [source] The absence of apoeccrine glands in the human axilla has disease pathogenetic implications, including axillary hyperhidrosisBRITISH JOURNAL OF DERMATOLOGY, Issue 6 2007D.L. Bovell Summary Background, The existence of a third type of sweat gland in human axillary skin, the apoeccrine gland, with a capacity to produce much higher sweat output than the eccrine gland, was proposed from examination of microdissected glands. However, previous studies of axillary skin glands did not examine the entire individual glandular structure via serial sections and the markers used to identify the different glands gave conflicting results and, hence, the existence of the apoeccrine gland remains controversial. Objectives, To investigate human axillary sweat glands by serial section histology and immunofluorescence. Methods, Human axillary sweat glands were investigated by serial sectioning of paraffin wax-embedded skin samples taken by biopsy from four male and six female volunteers (age range 20,35 years). Sections were examined by light microscopy and immunofluorescence, using antibodies to antigens reported to be markers for discriminating between eccrine and apocrine gland cells: CD15, CD44, S100 and human milk fat globulin. Results, Light microscopy demonstrated that there were hair follicles and a mean ± SD of 76 ± 14 sweat glands cm,2. Eccrine and apocrine glands were found to be present; however, no glands resembling the apoeccrine glands were detected. Both types of sweat gland exhibited signs of being active, with segments of the secretory coils displaying flattened cells and dilated glandular lumina; however, this dilation did not extend to obvious changes in the width of the gland. None of the eccrine glands exhibited evidence of the presence of apocrine cells or vice versa. Immunofluorescence markers were found not to be specific and did not discriminate between the different types of glands or demonstrate the presence of apoeccrine glands. Conclusions, This is the first time that serial sections of axillary skin have been examined by histology and immunofluorescence. The markers reported to discriminate between apocrine and eccrine glands were found to be nonspecific. No evidence of apoeccrine glands was found either by histology or by immunofluorescence. [source] | ||||||||||||||||