Home About us Contact
|
Home About us Contact | ||
|
|
||
Major Clusters (major + cluster)
Selected AbstractsUnsupervised immunophenotypic profiling of chronic lymphocytic leukemiaCYTOMETRY, Issue 3 2006Luzette K. Habib Abstract Background Proteomics and functional genomics have revolutionized approaches to disease classification. Like proteomics, flow cytometry (FCM) assesses concurrent expression of many proteins, with the advantage of using intact cells that may be differentially selected during analysis. However, FCM has generally been used for incremental marker validation or construction of predictive models based on known patterns, rather than as a tool for unsupervised class discovery. We undertook a retrospective analysis of clinical FCM data to assess the feasibility of a cell-based proteomic approach to FCM by unsupervised cluster analysis. Methods Multicolor FCM data on peripheral blood (PB) and bone marrow (BM) lymphocytes from 140 consecutive patients with B-cell chronic lymphoproliferative disorders (LPDs), including 81 chronic lymphocytic leukemia (CLLs), were studied. Expression was normalized for CD19 totals, and recorded for 10 additional B-cell markers. Data were subjected to hierarchical cluster analysis using complete linkage by Pearson's correlation. Analysis of CLL in PB samples (n = 63) discovered three major clusters. One cluster (14 patients) was skewed toward "atypical" CLL and was characterized by high CD20, CD22, FMC7, and light chain, and low CD23. The remaining two clusters consisted almost entirely (48/49) of cases recorded as typical BCLL. The smaller "typical" BCLL cluster differed from the larger cluster by high CD38 (P = 0.001), low CD20 (P = 0.001), and low CD23 (P = 0.016). These two typical BCLL clusters showed a trend toward a difference in survival (P = 0.1090). Statistically significant cluster stability was demonstrated by expanding the dataset to include BM samples, and by using a method of random sampling with replacement. Conclusions This study supports the concept that unsupervised immunophenotypic profiling of FCM data can yield reproducible subtypes of lymphoma/chronic leukemia. Expanded studies are warranted in the use of FCM as an unsupervised class discovery tool, akin to other proteomic methods, rather than as a validation tool. © 2006 International Society for Analytical Cytology [source] Soil microbial activity along an arctic-alpine altitudinal gradient from a seasonal perspectiveEUROPEAN JOURNAL OF SOIL SCIENCE, Issue 5 2008U. C. M. Löffler Summary The knowledge on dynamics of soil microbial activity and its correlation to climate and vegetation is still poor but essential for predicting climatic changes scenarios. Seasonal dynamics of soil microbial activity and cell counts were studied along an arctic-alpine altitudinal gradient. The gradient comprised 12 ridges from 1000 to 1600 m altitude. Soil samples were collected during March, May, July and September 2005. The effect of temperature, snow depth and vegetation, all of which changed with altitude, on soil microbial activity and bacterial cell counts was analysed. The potential activities of phosphatase and chitinase were determined using fluorescent 4-methylumbelliferyl labelled analogues. Total and live bacterial cell counts were determined by live-dead-staining. We detected marked differences in soil microbial variables along the altitudinal gradient, forming three major clusters: a low alpine belt, a middle alpine belt, and an intermediate transition zone. Our results demonstrated that more frequent occurrence of shrubs and bryophytes would also increase microbial activity. Furthermore, we detected a clear relation (R2 = 0.6; P < 0.02) between high soil temperatures and greater soil microbial activity during summer. As higher temperatures are predicted to promote shrubs and higher humidity to promote bryophytes we expect microbial activity in dry heath tundra soils will increase with anticipated warmer, and in the case of Scandinavia, more humid climates. We did not find winter microbial activity to be less at snow-free sites than at sites covered by snow up to depths of 30 cm; hence, possible future decreases in snow depth will not result in reduced winter microbial activity. We demonstrate that shrubs support winter microbial activity not only by trapping snow but also directly by increasing the amount of organic carbon. [source] Genetic diversity and biogeography of haloalkaliphilic sulphur-oxidizing bacteria belonging to the genus ThioalkalivibrioFEMS MICROBIOLOGY ECOLOGY, Issue 1 2006Mirjam Foti Abstract A group of 85 isolates of haloalkaliphilic obligately chemolithoautotrophic sulphur-oxidizing bacteria belonging to the genus Thioalkalivibrio were recently obtained from soda lakes in Mongolia, Kenya, California, Egypt and Siberia. They have been analyzed by repetitive extragenic palindromic (rep)-PCR genomic fingerprinting technique with BOX- and (GTG)5-primer set. Cluster analysis was performed using combined fingerprint profiles and a dendrogram similarity value (r) of 0.8 was used to define the same genotype. Fifty-six genotypes were found among the isolates, revealing a high genetic diversity. The strains can be divided into two major clusters, including isolates from the Asiatic (Siberia and Mongolia) and the African (Kenya and Egypt) continents, respectively. The majority (85.9%) of the genotypes were found in only one area, suggesting an endemic character of the Thioalkalivibrio strains. Furthermore, a correlation between fingerprint clustering, geographic origin and the characteristics of the lake of origin was found. [source] URP-based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of WheatJOURNAL OF PHYTOPATHOLOGY, Issue 4 2010Rashmi Aggarwal Abstract Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs') are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5,GTGTGCGATCAGTTGCTGGG3,) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. [source] Range-wide phylogeography and gene zones in Pinus pinaster Ait. revealed by chloroplast microsatellite markersMOLECULAR ECOLOGY, Issue 10 2007GABRIELE BUCCI Abstract Some 1339 trees from 48 Pinus pinaster stands were characterized by five chloroplast microsatellites, detecting a total of 103 distinct haplotypes. Frequencies for the 16 most abundant haplotypes (pk > 0.01) were spatially interpolated over a lattice made by 430 grid points. Fitting of spatially interpolated values on raw haplotype frequencies at the same geographical location was tested by regression analysis. A range-wide ,diversity map' based on interpolated haplotype frequencies allowed the identification of one ,hotspot' of diversity in central and southeastern Spain, and two areas of low haplotypic diversity located in the western Iberian peninsula and Morocco. Principal component analysis (PCA) carried out on haplotypes frequency surfaces allowed the construction of a colour-based ,synthetic' map of the first three PC components, enabling the detection of the main range-scale genetic trends and the identification of three main ,gene pools' for the species: (i) a ,southeastern' gene pool, including southeastern France, Italy, Corsica, Sardinia, Pantelleria and northern Africa; (ii) an ,Atlantic' gene pool, including all the western areas of the Iberian peninsula; and (iii) a ,central' gene pool, located in southeastern Spain. Multivariate and amova analyses carried out on interpolated grid point frequency values revealed the existence of eight major clusters (,gene zones'), whose genetic relationships were related with the history of the species. In addition, demographic models showed more ancient expansions in the eastern and southern ranges of maritime pine probably associated to early postglacial recolonization. The delineation of the gene zones provides a baseline for designing conservation areas in this key Mediterranean pine. [source] Clustering of amplified fragment length polymorphism markers in a linkage map of ryePLANT BREEDING, Issue 2 2002B. Saal Abstract Amplified fragment length polymorphisms (AFLPs) are now widely used in DNA fingerprinting and genetic diversity studies, the construction of dense genetic maps and in fine mapping of agronomically important traits. The AFLP markers have been chosen as a source to extend and saturate a linkage map of rye, which has previously been generated by means of restriction fragment length polymorphism, random amplified polymorphic DNA, simple sequence repeat and isozyme markers. Gaps between linkage groups, which were known to be part of chromosome 2R, have been closed, thus allowing the determination of their correct order. Eighteen EcoRI- MseI primer combinations were screened for polymorphism and yielded 148 polymorphic bands out of a total of 1180. The level of polymorphism among the different primer combinations varied from 5.7% to 33.3%. Eight primer combinations, which revealed most polymorphisms, were further analysed in all individuals of the F2 mapping population. Seventy-one out of 80 polymorphic loci could be integrated into the linkage map, thereby increasing the total number of markers to 182. However, 46% of the mapped AFLP markers constituted four major clusters located on chromosomes 2R, 5R and 7R, predominantly in proximity to the centromere. The integration of AFLP markers caused an increase of 215 cM, which resulted in a total map length of almost 1100 cM. [source] Genetic diversity, presence of the syrB gene, host preference and virulence of Pseudomonas syringae pv. syringae strains from woody and herbaceous host plantsPLANT PATHOLOGY, Issue 3 2003M. Scortichini A total of 101 Pseudomonas syringae pv. syringae strains, obtained from international culture collections or isolated from diseased tissues of herbaceous and woody plant species, were assessed by repetitive PCR using the BOX primer, and for the presence of the syrB gene. Representative strains were also tested for pathogenicity to lilac, pear, peach, corn and bean, as well as for virulence to lemon and zucchini fruits. The unweighted pair-group method using arithmethic averages analysis (UPGMA) of genomic fingerprints revealed 17 different patterns which grouped into three major clusters, A, B and C. Most of the strains (52·4%) were included in patterns 1,4 of group A. These patterns comprised strains obtained from either herbaceous or woody species, and showed four fragments of similar mobility. Genetic variability was ascertained for strains isolated from apple, pear, apricot, Citrus spp. and cereals. No clear relationship was observed between host plant and bacterial genomic fingerprint. Variability was also observed in pathogenicity and virulence tests. The inoculation of pear leaves discriminated strains isolated from pear as well as the very aggressive strains, whereas inoculation of lilac, peach and corn did not discriminate the host plant from which the strains were originally isolated. Lemon fruit inoculation proved very effective for P. syringae pv. syringae virulence assessment. The syrB gene was present in almost all strains. [source] Patterns of dysmorphic features in schizophrenia,AMERICAN JOURNAL OF MEDICAL GENETICS, Issue 8 2001L.E. Scutt Abstract Congenital dysmorphic features are prevalent in schizophrenia and may reflect underlying neurodevelopmental abnormalities. A cluster analysis approach delineating patterns of dysmorphic features has been used in genetics to classify individuals into more etiologically homogeneous subgroups. In the present study, this approach was applied to schizophrenia, using a sample with a suspected genetic syndrome as a testable model. Subjects (n,=,159) with schizophrenia or schizoaffective disorder were ascertained from chronic patient populations (random, n,=,123) or referred with possible 22q11 deletion syndrome (referred, n,=,36). All subjects were evaluated for presence or absence of 70 reliably assessed dysmorphic features, which were used in a three-step cluster analysis. The analysis produced four major clusters with different patterns of dysmorphic features. Significant between,cluster differences were found for rates of 37 dysmorphic features (P,<,0.05), median number of dysmorphic features (P,=,0.0001), and validating features not used in the cluster analysis: mild mental retardation (P,=,0.001) and congenital heart defects (P,=,0.002). Two clusters (1 and 4) appeared to represent more developmental subgroups of schizophrenia with elevated rates of dysmorphic features and validating features. Cluster 1 (n,=,27) comprised mostly referred subjects. Cluster 4 (n,=,18) had a different pattern of dysmorphic features; one subject had a mosaic Turner syndrome variant. Two other clusters had lower rates and patterns of features consistent with those found in previous studies of schizophrenia. Delineating patterns of dysmorphic features may help identify subgroups that could represent neurodevelopmental forms of schizophrenia with more homogeneous origins. © 2001 Wiley-Liss, Inc. [source] Genetic structure of Eurasian cattle (Bos taurus) based on microsatellites: clarification for their breed classification,ANIMAL GENETICS, Issue 2 2010M.-H. Li Summary We pool three previously published data sets and present population genetic analyses of microsatellite variation in 48 Bos taurus cattle breeds from a wide range of geographical origins in Eurasia, mostly its northern territory. Bayesian model-based clustering reveals six distinct clusters: besides a single-population cluster of the Yakutian Cattle from Far Eastern Siberia and a cluster of breeds characteristic of an early origin, the other four major clusters largely correspond to previously defined morphological subgroups of Red Lowland, Lowland Black-Pied, Longhorned Dairy and North European Polled cattle breeds. The results highlighted past expansion events of the productive breeds such as Danish Red, Angeln, Holstein-Friesian and Ayrshire in northern and Eastern Europe. Based on genetic assignment of the breeds and the availability of breed information, we provide a preliminary classification of the five breeds that were to date undefined. Furthermore, in the analysis of molecular variance, despite some correspondence between geographical proximity and genetic similarity, the breed classification appears to be a better predictor of genetic structure in the cattle populations (the among-group variance component: breed classification, 2.47%, P < 0.001; geographical division, 0.77%, P < 0.001). [source] Mitochondrial diversity of native pigs in the mainland South and South-east Asian countries and its relationships between local wild boarsANIMAL SCIENCE JOURNAL, Issue 4 2008Kazuaki TANAKA ABSTRACT In this study, we analyzed DNA sequence of mitochondrial DNA (mtDNA) control regions on the 130 native domestic pigs and eight wild boars in the mainland South and South-east Asian countries including Bhutan, Cambodia, Laos, Myanmar, and Vietnam. Forty-four haplotypes were found in the 138 individuals, 41 were in the domestic and four were in wild boars. Only one haplotype was shared by domestic and wild population in Bhutan. In other cases, mtDNA of wild boars did not show close affinity to that of the domestic pigs in the same location, indicating that the native domestic pigs in these countries did not originate in the present habitat. Phylogenetic analyzes of mtDNA haplotypes recapitulated several major clusters identified in other studies, but 11 haplotypes were grouped in a new cluster we named MTSEA. In most cases, more than one lineage group were present in a sampling station, indicating that the present indigenous domestic pigs may have multiple origins. The MTSEA haplotypes were present in relatively high frequencies in domestic pigs in the mountainous area of mainland South-east Asia (Cambodia and Laos), with a few found in Myanmar and Bhutan. The distributions of MTSEA haplotypes are in great conformity with the distribution of present-day Mon-Khmer language and indicated the existence of yet another independent domestication. The D2 haplotypes that distribute high frequency (almost 100%) throughout the Chinese breeds were dominant in Bhutan, Myanmar, and Vietnam. These results suggest an existence of human-mediated dispersal of domestic pigs from north to the south during the historical expansion of Sino-Tibetan and Tai peoples. The D3 haplotypes previously reported in north India were found in sympatric domestic and wild pigs in Bhutan. The D3 haplotype is an important proof of independent domestication event and/or great gene flow between wild and domestic pigs in the foot of Himalaya. [source] Sponge morphological diversity: a qualitative predictor of species diversity?AQUATIC CONSERVATION: MARINE AND FRESHWATER ECOSYSTEMS, Issue 2 2001James J. Bell Abstract 1.,To the non-specialist, problems are often associated with the quantification of sponge species diversity, as colour, shape and size can be highly variable within a single species. These variables can lead to an under-estimation of the contribution of sponges to the biodiversity of the benthos especially during biological surveys. 2.,Sponge species diversity (Shannon H, values), richness (mean number of species) and morphological diversity (Shannon H, values) were sampled at six sites (6 m depth intervals) on vertical (90°) and inclined surfaces (45°) experiencing different flow regimes at Lough Hyne Marine Nature Reserve (Ireland). Morphological diversity was sampled independently of species diversity. The time taken for the collection of both species and morphological diversity was recorded. 3.,Morphological diversity was positively correlated with both sponge species diversity (r2=0.87, p<0.05) and sponge species richness (r2=0.70, p<0.05). Linear regression was found to be significant for both the relationships (p<0.05 for each F -value). A sigmoidal relationship (r2=0.97, p<0.05) was found between morphological and species richness which proved to be significant (F -value 40.67, p<0.05). Separate Bray,Curtis dendrograms and correspondence analysis of morphological and species community compositions at the six sites showed very similar clustering and four major clusters were identified. 4.,The results of the present study indicate that sampling of sponge morphological diversity, rather than sponge species diversity and richness may be used as a qualitative estimate of sponge species diversity. Sampling of morphological diversity is much less time consuming, both in the field and laboratory, than collecting species diversity data and no specialist knowledge is required. Consideration is given to the use of such relationships in biological surveys and bio-monitoring. Copyright © 2001 John Wiley & Sons, Ltd. [source] Mitochondrial cytochrome b sequence yields new insight into the speciation of social voles in south-west AsiaBIOLOGICAL JOURNAL OF THE LINNEAN SOCIETY, Issue 1 2009BORIS KRY, TUFEK We established a cytochrome b (cyt b) phylogeny for six species of social voles. A Bayesian approach to phylogenetic reconstruction (BI) and a maximum likelihood (ML) tree revealed a dichotomy into two major clusters, namely a Microtus guentheri cluster and a M. socialis cluster. The three main lineages that emerged within each of these two clusters were separated by the K2P divergences which are above the intraspecific variation in Microtus. All six species were also retrieved in the minimum spanning network. Within its present taxonomic scope, M. guentheri is paraphyletic and consists of two allopatric sibling species: M. guentheri (Syria, Israel) and M. hartingi (Anatolia and the Balkans). The closest relative to these two species is M. dogramacii, which is possibly a sister species to M. hartingi. The two geographic samples were identified as M. irani, one from Shiraz (Iran) and the other from Balkusan (Turkey). The cyt b sequence confirmed the specific status of M. anatolicus within the M. socialis cluster. Although five species of social voles occur within a radius of < 500 km in the north-eastern corner of the Mediterranean, small-scale sympatry is exceptional. Species richness in this region possibly originates from past fragmentation with subsequent allopatric speciation in refugial areas. © 2009 The Linnean Society of London, Biological Journal of the Linnean Society, 2009, 98, 121,128. [source] The protein kinase C agonist PEP005 increases NF-,B expression, induces differentiation and increases constitutive chemokine release by primary acute myeloid leukaemia cellsBRITISH JOURNAL OF HAEMATOLOGY, Issue 6 2009Astrid Marta Olsnes Summary Acute myeloid leukaemia (AML) cells show constitutive release of several chemokines that occurs in three major clusters: (I) chemokine (C-C motif) ligand (CCL)2,4/chemokine (C-X-C motif) ligand (CXCL)1/8, (II) CCL5/CXCL9,11 and (III) CCL13/17/22/24/CXCL5. Ingenol-3-angelate (PEP005) is an activator of protein kinase C and has antileukaemic and immunostimulatory effects in AML. We investigated primary AML cells derived from 35 unselected patients and determined that PEP005 caused a dose-dependent increase in the release of chemokines from clusters I and II, including several T cell chemotactic chemokines. The release of granulocyte-macrophage colony-stimulating factor and hepatocyte growth factor was also increased. CCL2,4/CXCL1/8 release correlated with nuclear factor (NF)-,B expression in untreated AML cells, and PEP005-induced chemokine production was associated with further increases in the expression of the NF-,B subunits p50, p52 and p65. Increased DNA binding of NF-,B was observed during exposure to PEP005, and the specific NF-,B inhibitor BMS-345541 reduced constitutive chemokine release even in the presence of PEP005. Finally, PEP005 decreased expression of stem cell markers (CD117, CXCR4) and increased lineage-associated CD11b and CD14 expression. To conclude, PEP005 has a unique functional pharmacological profile in human AML. Previous studies have described proapoptotic and T cell stimulatory effects and the present study describes additional T cell chemotactic and differentiation-inducing effects. [source] | ||||||||||