Home About us Contact
|
Home About us Contact | ||
|
|
||
Geographic Regions (geographic + regions)
Kinds of Geographic Regions Selected AbstractsRapid Analysis of Glucose, Fructose, Sucrose, and Maltose in Honeys from Different Geographic Regions using Fourier Transform Infrared Spectroscopy and Multivariate AnalysisJOURNAL OF FOOD SCIENCE, Issue 2 2010Jun Wang ABSTRACT:, Quantitative analysis of glucose, fructose, sucrose, and maltose in different geographic origin honey samples in the world using the Fourier transform infrared (FTIR) spectroscopy and chemometrics such as partial least squares (PLS) and principal component regression was studied. The calibration series consisted of 45 standard mixtures, which were made up of glucose, fructose, sucrose, and maltose. There were distinct peak variations of all sugar mixtures in the spectral "fingerprint" region between 1500 and 800 cm,1. The calibration model was successfully validated using 7 synthetic blend sets of sugars. The PLS 2nd-derivative model showed the highest degree of prediction accuracy with a highest,R2 value of 0.999. Along with the canonical variate analysis, the calibration model further validated by high-performance liquid chromatography measurements for commercial honey samples demonstrates that FTIR can qualitatively and quantitatively determine the presence of glucose, fructose, sucrose, and maltose in multiple regional honey samples. [source] A Comparison of Cryptosporidium Subgenotypes from Several Geographic RegionsTHE JOURNAL OF EUKARYOTIC MICROBIOLOGY, Issue 2001MICHAEL M. PENG [source] Effect of housing factors and surficial uranium on the spatial prediction of residential radon in IowaENVIRONMETRICS, Issue 5 2007Brian J. Smith Abstract Growing epidemiologic evidence suggests that residential radon is an important risk factor for lung cancer. Consequently, public health professionals have expressed interest in characterizing the spatial distribution of radon concentrations in order to identify geographic regions of high exposure. Ambient radon concentrations are a function of geologic features including soil radium content. Indoor radon concentrations can vary based on building characteristics that affect the entry of radon into the building and movement between rooms therein. We present a geostatistical hierarchical Bayesian model for radon that allows for spatial prediction based on geologic data and housing characteristics. Our model is applied to radon data from an epidemiologic study in Iowa that consist of 136 outdoor measurements and 2590 indoor measurements from 614 residential homes. Housing characteristics collected in the Iowa Study are included as predictors in the model. Geologic data in the form of county-average surficial uranium concentrations from the USGS National Uranium Resource Evaluation project are also considered. A ,change of support' approach is implemented to combine the radon measurements, collected at points in space, and the uranium concentrations, averaged over counties, so that point-source concentrations for the latter are available for the analysis. Estimates of the effect of select housing factors on radon are provided along with spatial maps of predicted radon concentrations in Iowa. Copyright © 2006 John Wiley & Sons, Ltd. [source] Predicting the impacts of an introduced species from its invasion history: an empirical approach applied to zebra mussel invasionsFRESHWATER BIOLOGY, Issue 6 2003Anthony Ricciardi SUMMARY 1.,Quantitative models of impact are lacking for the vast majority of known invasive species, particularly in aquatic ecosystems. Consequently, managers lack predictive tools to help them prioritise invasion threats and decide where they can most effectively allocate limited resources. Predictive tools would also enhance the accuracy of water quality assessments, so that impacts caused by an invader are not erroneously attributed to other anthropogenic stressors. 2.,The invasion history of a species is a valuable guide for predicting the consequences of its introduction into a new environment. Regression analysis of data from multiple invaded sites can generate empirical models of impact, as is shown here for the zebra mussel Dreissena polymorpha. Dreissena's impacts on benthic invertebrate abundance and diversity follow predictable patterns that are robust across a range of habitat types and geographic regions. Similar empirical models could be developed for other invaders with a documented invasion history. 3.,Because an invader's impact is correlated with its abundance, a surrogate model may be generated (when impact data are unavailable) by relating the invader's abundance to environmental variables. Such a model could help anticipate which habitats will be most affected by invasion. Lack of precision should not be a deterrent to developing predictive models where none exist. Crude predictions can be refined as additional data become available. Empirical modelling is a highly informative and inexpensive, but underused, approach in the management of aquatic invasive species. [source] Using species distribution models to identify suitable areas for biofuel feedstock productionGCB BIOENERGY, Issue 2 2010JASON M. EVANS Abstract The 2007 Energy Independence and Security Act mandates a five-fold increase in US biofuel production by 2022. Given this ambitious policy target, there is a need for spatially explicit estimates of landscape suitability for growing biofuel feedstocks. We developed a suitability modeling approach for two major US biofuel crops, corn (Zea mays) and switchgrass (Panicum virgatum), based upon the use of two presence-only species distribution models (SDMs): maximum entropy (Maxent) and support vector machines (SVM). SDMs are commonly used for modeling animal and plant distributions in natural environments, but have rarely been used to develop landscape models for cultivated crops. AUC, Kappa, and correlation measures derived from test data indicate that SVM slightly outperformed Maxent in modeling US corn production, although both models produced significantly accurate results. When compared with results from a mechanistic switchgrass model recently developed by Oak Ridge National Laboratory (ORNL), SVM results showed higher correlation than Maxent results with models fit using county-scale point inputs of switchgrass production derived from expert opinion estimates. However, Maxent results for an alternative switchgrass model developed with point inputs from research trial sites showed higher correlation to the ORNL model than the corresponding results obtained from SVM. Further analysis indicates that both modeling approaches were effective in predicting county-scale increases in corn production from 2006 to 2007, a time period in which US corn production increased by 24%. We conclude that presence-only methods are a powerful first-cut tool for estimating relative land suitability across geographic regions in which candidate biofuel feedstocks can be grown, and may also provide important insight into potential land-use change patterns likely to be associated with increased biofuel demand. [source] Poleward shifts in breeding bird distributions in New York StateGLOBAL CHANGE BIOLOGY, Issue 8 2009BENJAMIN ZUCKERBERG Abstract Like other regions of the northern hemisphere, the northeastern United States has experienced a general increase in regional temperatures over the past 20 years. Quantifying the ecological implications of these changing temperatures has been severely constrained by a lack of multispecies distributional data by which to compare long-term changes. We used the New York State Breeding Bird Atlas, a statewide survey of 5332 25 km2 blocks surveyed in 1980,1985 and 2000,2005, to test several predictions that the birds of New York State are responding to climate change. Our objective was to use an information-theoretic approach to analyze changes in three geographic range characteristics, the center of occurrence, range boundaries, and states of occurrence to address several predictions that the birds of New York State are moving polewards and up in elevation. As expected, we found all bird species (n=129) included in this analysis showed an average northward range shift in their mean latitude of 3.58 km [Prob(Ha|data)=0.87)]. Past studies have found that northern range boundaries are more likely to be influenced by climatic factors than southern range boundaries. Consequently, we predicted that northward shifts would be more evident in northern as opposed to southern range boundaries. We found, however, that the southern range boundaries of northerly birds moved northward by 11.4 km [n=43, Prob(Ha|data)=0.92], but this pattern was less evident in northern range boundaries of southerly birds. In addition, we found that bird species demonstrated a general shift downhill in their mean elevation, but demonstrated little change in their elevational boundaries. The repeated pattern of a predicted northward shift in bird ranges in various geographic regions of the world provides compelling evidence that climate change is driving range shifts. [source] Large-scale plant light-use efficiency inferred from the seasonal cycle of atmospheric CO2GLOBAL CHANGE BIOLOGY, Issue 8 2004Christopher J. Still Abstract We combined atmospheric CO2 measurements, satellite observations, and an atmospheric transport model in an inverse modeling framework to infer a key property of vegetation physiology, the light-use efficiency (LUE) of net primary production, for large geographic regions. We find the highest LUE in boreal regions and in the northern hemisphere tropics. Within boreal zones, Eurasian LUE is higher than North American LUE and has a distinctly different seasonal profile. This longitudinal asymmetry is consistent with ecological differences expected from the much greater cover of deciduous vegetation in boreal Eurasia caused by the vast Siberian forests of the deciduous conifer, Larch. Inferred LUE of the northern hemisphere tropics is also high and displays a seasonal profile consistent with variations of both cloud cover and C4 vegetation activity. [source] Health care funding levels and patient outcomes: a national studyHEALTH ECONOMICS, Issue 4 2007Margaret M. Byrne Abstract Background: Health care funding levels differ significantly across geographic regions, but there is little correlation between regional funding levels and outcomes of elderly Medicare beneficiaries. Our goal was to determine whether this relationship holds true in a non-Medicare population cared for in a large integrated health care system with a capitated budget allocation system. Methods: We explored the association between health care funding and risk-adjusted mortality in the 22 Veterans Affairs (VA) geographic Networks over a six-year time period. Allocations to Networks were adjusted for illness burden using Diagnostic Cost Groups. To test the association between funding and risk-adjusted three-year mortality, we ran logistic regressions with single-year patient cohorts, as well as hierarchical regressions on a six year longitudinal data set, clustering on VA Network. Results: A $1000 increase in funding per unit of patient illness burden was associated with a 2,8% reduction in three-year mortality in cross sectional regressions. However, in longitudinal hierarchical regressions clustering on Network, the significant effect of funding level was eliminated. Conclusions: When longitudinal data are used, the significant cross sectional effect of funding levels on mortality disappear. Thus, the factors driving differences in mortality are Network effects, although part of the Network effect may be due to past levels of funding. Our results provide a caution for cross sectional examinations of the association between regional health care funding levels and health outcomes. Copyright © 2006 John Wiley & Sons, Ltd. [source] Overlooked and underutilized: People with disabilities are an untapped human resourceHUMAN RESOURCE MANAGEMENT, Issue 2 2008Mark L. Lengnick-Hall The retirement of baby boomers along with a smaller cohort group of young people replacing them poses a challenge for employers in the future,where will they find the workers they need? One largely untapped source of human resources is people with disabilities (PWDs). Why have employers mostly ignored this large labor pool? This research used a semistructured interview approach with 38 executives across a broad array of industries and geographic regions to examine why employers don't hire PWDs and what they believe can be done to change this situation. Results show that most employers are not very proactive in hiring PWDs and that most employers hold stereotypical beliefs not supported by research evidence. © 2008 Wiley Periodicals, Inc. [source] Prevalence of glucose-6-phosphate dehydrogenase deficiency in Northern GreeceINTERNAL MEDICINE JOURNAL, Issue 3 2008G. Ntaios Abstract Glucose-6-phosphate dehydrogenase (G6PD) deficiency affects more than 400 million persons worldwide. Its distribution varies significantly among different geographic regions and different population groups. Purpose of our study was to estimate its prevalence in Northern Greece. The dataset comprised 5161 newborns and adults who were screened for G6PD deficiency between July 2001 and March 2007. G6PD deficiency was detected by the dye reduction method. In the screened group, 6.3% of subjects were G6PD deficient. Moderate enzyme deficiency was shown in 139 individuals (2.7%). Complete deficiency was identified in 3.7%. The prevalence of G6PD deficiency in Northern Greece is much higher compared with the general Greek population. Moreover, G6PD prevalence in the male sex is much higher , almost double , that in the female sex. [source] Underdiagnosis of Vertebral Fractures Is a Worldwide Problem: The IMPACT StudyJOURNAL OF BONE AND MINERAL RESEARCH, Issue 4 2005Pierre D Delmas MD Abstract Accurate radiographic diagnosis of vertebral fractures is important. This multicenter, multinational study assessed radiographic diagnoses of vertebral fracture in 2451 postmenopausal women with osteoporosis. Comparison between local and central readings yielded a false-negative rate of 34%. Underdiagnosis of vertebral fracture is a worldwide problem. Introduction: Vertebral fractures are the most common complication of osteoporosis. Although they are associated with significant morbidity, they frequently do not come to clinical attention. Accurate radiographic diagnosis is important. Materials and Methods: In a multicenter, multinational prospective study (the IMPACT trial), the accuracy of radiographic diagnosis of vertebral fracture was evaluated in postmenopausal women 65,80 years of age newly diagnosed with osteoporosis (based on BMD measurement). Lateral radiographs of the thoracolumbar spine were evaluated for identification of vertebral fractures, first locally and subsequently at a central reading center, using a validated semiquantitative method. False-positive and false-negative rates were calculated based on adjudicated discrepancies between the initial interpretation at the local site and the subsequent central reading, considered the "reference standard." Results: Of 2451 women with an evaluable radiograph both centrally and locally, 789 (32%) had at least one vertebral fracture. Adjudicated discrepancies (n = 350 patients) between local and central readings because of undetected vertebral fracture (68%) or equivocal terminology in the local radiology report (32%) yielded a false-negative rate of 34%. Conclusions: Underdiagnosis of vertebral fractures was observed in all geographic regions (false-negative rates: North America, 45.2%; Latin America, 46.5%; Europe/South Africa/Australia, 29.5%). The false-positive rate was 5% globally. Underdiagnosis of vertebral fracture is a worldwide problem attributable in part to a lack of radiographic detection, use of ambiguous terminology in the radiology report, or both. Efforts to improve accuracy and reduce variability in terminology and interpretation may increase the effectiveness of spinal radiography for detecting vertebral fractures in patients with osteoporosis. [source] Absence of Borrelia burgdorferi DNA in cutaneous B-cell lymphomas from the United StatesJOURNAL OF CUTANEOUS PATHOLOGY, Issue 10 2001Gary S. Wood Background: An association between Borrelia burgdorferi and cutaneous B-cell lymphoma (CBCL) has been made in several European countries. The evidence in favor of such an association has recently been based on more definitive tests for the pathogenetic role of B. burgdorferi in CBCL, including positive cultures or polymerase chain reaction (PCR) amplification of borrelial DNA from lesional skin. However, there is only one report of B. burgdorferi in four North American cases of B-cell lymphoma. Methods: We retrieved 38 cases of primary and secondary CBCL from different geographic regions of the United States. Two separate techniques were used to detect borrelial DNA by PCR, a nested PCR method to amplify a B. burgdorferi -specific gene as well as a borrelial chromosomal Ly-1 clone amplification method. Southern blot hybridization was used for confirmation of the PCR results. Results: No B. burgdorferi -specific DNA was detected in any of the 38 CBCL cases, whereas detectable PCR products were obtained with our positive controls. Conclusions: Our findings, in light of previous studies, suggest that B. burgdorferi plays a minimal role in the development or pathogenesis of CBCL in the United States. The findings also suggest that the geographic variations in the clinical manifestations of B. burgdorferi are indeed real and may be secondary to the genetic and phenotypic differences between B. burgdorferi strains present in Europe and North America. [source] An Empirical Assessment of Country Risk Ratings and Associated ModelsJOURNAL OF ECONOMIC SURVEYS, Issue 4 2004Suhejla Hoti Abstract., Country risk has become a topic of major concern for the international financial community over the last two decades. The importance of country ratings is underscored by the existence of several major country risk rating agencies, namely the Economist Intelligence Unit, Euromoney, Institutional Investor, International Country Risk Guide, Moody's, Political Risk Services, and Standard and Poor's. These risk rating agencies employ different methods to determine country risk ratings, combining a range of qualitative and quantitative information regarding alternative measures of economic, financial and political risk into associated composite risk ratings. However, the accuracy of any risk rating agency with regard to any or all of these measures is open to question. For this reason, it is necessary to review the literature relating to empirical country risk models according to established statistical and econometric criteria used in estimation, evaluation and forecasting. Such an evaluation permits a critical assessment of the relevance and practicality of the country risk literature. The paper also provides an international comparison of risk ratings for twelve countries from six geographic regions. These ratings are compiled by the International Country Risk Guide, which is the only rating agency to provide detailed and consistent monthly data over an extended period for a large number of countries. The time series data permit a comparative assessment of the international country risk ratings, and highlight the importance of economic, financial and political risk ratings as components of a composite risk rating. [source] Molecular epidemiology of hepatitis A virus in Korea,JOURNAL OF GASTROENTEROLOGY AND HEPATOLOGY, Issue 5 2001Kwan Soo Byun Abstract Background: The prevalence of antibodies for hepatitis A virus (anti-HAV) in adolescents and young adults has decreased remarkably following the economic growth in Korea. As a result, this age group has a high risk for HAV infection paradoxically, and over 1500 cases of clinically overt hepatitis A occurred in 1998. Human isolates of hepatitis A virus (HAV) are categorized within four genotypes (I, II, III, and VII). In some geographic regions, closely related isolates cluster, suggesting endemic spread of the virus, while in other regions multiple genotypes circulate. Virtually no data are available with regard to the genetic relatedness of Korean strains of HAV. Methods and Results: A 168 base pair segment encompassing the putative VP1/2A junction of the HAV genome was amplified by RT-PCR and sequenced in sera of 18 Korean patients with a sporadic form of acute hepatitis A. Pairwise comparisons of the nucleic acid and amino acid sequences of 18 Korean isolates with one another revealed that the Korean isolates showed > 94.6% and > 96.4% identity, respectively. All of the 18 Korean isolates clustered within genotype IA, irrespective of the geographic locations and the time that hepatitis occurred. Unique amino acid sequence changes that had never been reported in genotype IA were found in nine of the 18 isolates. These changes were Gln,Ser and Lys,Arg in 2A-19 and 2A-10 amino acid positions. Conclusion: The presence of single genotype and unique mutations may be related with the circulation of endemic HAV over a long period of time in Korea. [source] Ambulatory Use of Ticlopidine and Clopidogrel in Association with Percutaneous Coronary Revascularization Procedures in a National Managed Care OrganizationJOURNAL OF INTERVENTIONAL CARDIOLOGY, Issue 3 2002DEBORAH SHATIN PH.D. The aim of this study was to quantify ambulatory use of ticlopidine and clopidogrel in association -with percutaneous coronary revascularization procedures (PTCA, atherectomy, stent) in a national managed care organization. Retrospective administrative claims data over a 3-year period (1996,1998) from 12 UnitedHealth Group-affiliated health plans in four geographic regions were collected. Pharmacy and medical claims data were used to determine the patients exposed to ticlopidine and clopidogrel between January 1, 1996 and December 31, 1998, the duration of use, prescriptions within 2 weeks of a coronary procedure, and stent patients prescribed either drug within 2 weeks of stent placement in 1998. Substantial short-term use of ticlopidine and clopidogrel was found. The percentage of members with duration of use , 30 days ranged from 50.4% in 1996 to 56.9% in 1998 for ticlopidine and was 52.7% for clopidogrel. In 1998, 46% and 33% of ticlopidine and clopidogrel users, respectively, had a medical claim for a coronary procedure that fell within 2 weeks of a prescription. The rate was lower for Medicare beneficiaries. In 1998, 78% of stent patients filled a prescription for either drug within 2 weeks of stent implantation. Although little difference was found overall in the use of these agents across geographic regions, a higher proportion of stent patients in the Southeast were prescribed ticlopidine within this timeframe. The findings suggest that during the study time period ticlopidine and clopidogrel are frequently used off-label in association with percutaneous coronary revascularization procedures. These results were important in considering the overall benefit-risk profile. [source] URP-based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of WheatJOURNAL OF PHYTOPATHOLOGY, Issue 4 2010Rashmi Aggarwal Abstract Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs') are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5,GTGTGCGATCAGTTGCTGGG3,) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. [source] Use of RAPD and ISSR Markers in Detection of Genetic Variation and Population Structure among Fusarium oxysporum f. sp. ciceris Isolates on Chickpea in TurkeyJOURNAL OF PHYTOPATHOLOGY, Issue 3 2008H. Bayraktar Abstract Genetic variation among the isolates of Fusarium oxysporum f. sp. ciceris, the causal agent of chickpea wilt worldwide, was analysed using pathogenicity tests and molecular markers , random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) polymorphism. Hundred and eight isolates were obtained from diseased chickpea plants in 13 different provinces of Turkey, out of which 74 isolates were assessed using 30 arbitrary decamer primers and 20 ISSR primers. Unweighted pair-grouped method by arithmetic average cluster analysis of RAPD, ISSR and RAPD + ISSR datasets provided a substantially similar discrimination among Turkish isolates and divided into three major groups. Group 1, 2 and 3 consisted of 41, 18 and 15 isolates, respectively. These methods revealed a considerable genetic variation among Turkish isolates, but no correlation with regard to the clustering of isolates from different geographic regions. Analysis of molecular variance confirmed that most genetic variability resulted from the differences among isolates within regions. Our results also indicated that the low-genetic differentiation (FST) and high gene flow (Nm) among populations had a significant effect on the emergence and evolutionary development of F. oxysporum f. sp. ciceris. This is the first report on genetic diversity and population structure of F. oxysporum isolates on chickpea in Turkey. [source] Host Specialization among Vegetative Compatibility Groups of Verticillium dahliae in Relation to Verticillium longisporumJOURNAL OF PHYTOPATHOLOGY, Issue 3 2002K. ZEISE A collection of 24 isolates of Verticillium dahliae and 10 isolates of Verticillium longisporum originating from nine different host plants and from several geographic regions was tested for host specificity on 11 economically important crops such as potato, tomato, strawberry, linseed, three legumes and four Brassica species. In order to reveal host specificity the potential of each isolate to induce disease and affect plant yield was recorded for all isolate,host combinations. The collected data were statistically processed by means of a cluster analysis. As a result, the host range of individual isolates was found to be more dependent on the vegetative compatibility group (VCG) of the isolate than on its original host plant provenance. Twenty-two out of 24 V. dahliae isolates belonged to either VCG 2B or 4B. VCG 2B isolates showed specificity for legumes, strawberry, potato and linseed, whereas VCG 4B was specifically virulent on potato, strawberry and linseed. Subgroups within VCG 2B and 4B almost lacking any host preference were designated 2B* and 4B*. Three isolates from VCG 2B*, however, severely attacked tomato which is a host outside the authentic host range of VCG 2B. The pathogenicity of V. longisporum isolates was restricted to cruciferous hosts. Conversely, cruciferous plants were not affected by isolates from VCGs 2B and 4B of V. dahliae. This lack of cross-infectivity of certain subpopulations of V. dahliae and of V. longisporum may be useful in the management of this soil-borne wilt disease. [source] Morphological and Physiological Differentiation among Vegetative Compatibility Groups of Verticillium dahliae in Relation to V. longisporumJOURNAL OF PHYTOPATHOLOGY, Issue 7-8 2001K. Zeise Abstract Twenty-four isolates of Verticillium dahliae from various geographic regions and host origins were assigned to vegetative compatibility groups (VCG) based on complementation between nitrate-non-utilizing (nit) mutants. The VCG assignment was associated with clearly distinguishable morphological and physiological characteristics. Most isolates of VCG 2B produced deep black colonies, small conidia (3.62 × 0.02 , m), and spherical microsclerotia. They exhibited polyphenol oxidase (PPO) activity, high sporulation rate in shake cultures, fluorescence on sanguinarine-amended PDA (snPDA) and excretion of dark pigment on Czapek Dox agar. The isolates assigned to VCG 4B had significantly longer conidia (4.73 × 0.04 , m), spherical microsclerotia and white, fluffy colonies due to enhanced production of aerial mycelium. They excreted only traces of dark pigment, exhibited PPO activity, did not fluoresce on snPDA and had limited ability to sporulate in shake cultures. Except for lacking PPO activity the only heterokaryon self-incompatible isolate (HSI) was similar to VCG 4B. Ten isolates of Verticillium longisporum from cruciferous hosts did not produce nit mutants. They had clearly longer conidia (7.41 × 0.05 , m), formed elongate microsclerotia, and only poorly sporulated in shake cultures. They did not excrete dark pigment, lacked PPO, and failed to fluoresce on snPDA. The results indicate a clear morphological and physiological differentiation not only between the two species V. longisporum and V. dahliae but also among the VCGs of V. dahliae. [source] Classification and design of teledermatology practice: What dermatoses?JOURNAL OF THE EUROPEAN ACADEMY OF DERMATOLOGY & VENEREOLOGY, Issue 8 2009Which technology to apply? Abstract Dermatologists are mostly confined to urban regions and rural population is deprived of specialist care. Teledermatology Practice (TDP) is a solution to overcome this global problem. Tools for TDP includes video conference, store and forward, hybrid, mobile, satellite communication, integration model, nurse-led teledermatology, teledermatology focusing on difficult-to-manage cases, teledermoscopy, and teledermatopathology with combined applications. This article reviews the feasibility studies focusing teledermatology tools and analyses the possible options in designing TDP. Categorizing dermatoses for TDP depends on the purpose and types of technology. The dermatoses presenting from a remote geographic regions requires any of the following approaches (i) only TDP, (b) initial TDP followed by face-to-face, (iii) initial face-to-face followed by TDP and (iv) only face-to-face examination. The technology should suit the dermatoses, meet the purpose, be cost-effective and provide better management with follow-up care. We recommend store and forward as a basic TDP model as most dermatoses are diagnosed and follow-up care is delivered. Leprosy, pigmented skin lesions, leg ulcers, HIV and endemic dermatoses require screening and triage services using mobile teledermatology. Counselling and education require videoconference. Rural dermatology's camps require satellite communication mounted on a vehicle. Objective assessment (vitiligo and leg ulcer) after treatment requires integration model at a tertiary centre. Difficult-to-manage cases require second opinion using hybrid/store and forward TDP. Lower rural centre are provided with mobile/ store and forward teledermatology services. Selected or major community centre should be equipped with hybrid teledermatology and linked to a tertiary centre. This process helps healthcare administration to plan a TDP to cover all dermatoses, utilizing the available health care professional (HCP) and technology with minimum budget investment. Conflicts of interest None declared. [source] Immunotoxic activity of ochratoxin AJOURNAL OF VETERINARY PHARMACOLOGY & THERAPEUTICS, Issue 2 2006L. AL-ANATI Ochratoxin A (OTA) is an immunosuppressant fungal compound, produced by toxigenic species of Aspergillus and Penicillium fungi in a wide variety of climates and geographical regions. The contamination of food by this mycotoxin takes place primarily during preharvest periods. Almost all types of food can be contaminated. In addition, its chemical stability against heat and during industrial food processing makes OTA one of the most abundant food contaminating mycotoxins. Due in part to its long serum half-life in man, almost 100% of all human blood samples from some geographic regions may be positive for OTA. The immunosuppressant activity of OTA is characterized by size reduction of vital immune organs, such as thymus, spleen, and lymph nodes, depression of antibody responses, alterations in the number and functions of immune cells, and modulation of cytokine production. The immunotoxic activity of OTA probably results from degenerative changes and cell death following necrosis and apoptosis, in combination with slow replacement of affected immune cells, due to inhibition of protein synthesis. [source] Phylogenetic analysis of Alpine voles of the Microtus multiplex complex using the mitochondrial control regionJOURNAL OF ZOOLOGICAL SYSTEMATICS AND EVOLUTIONARY RESEARCH, Issue 4 2000E. Haring To elucidate the phylogenetic relationships of Alpine voles comprising the Microtus multiplex complex and related species the mitochondrial control region (CR) was employed as a genetic marker. Forty specimens were analysed representing the taxa Microtus liechtensteini, Microtus multiplex, and Microtus bavaricus (samples from 11 geographic regions) as well as specimens of Microtus subterraneus, Microtus tatricus, Microtus arvalis, Microtus agrestis, Microtus oeconomus, and Chionomys nivalis. The haplotypes from Tuscany and the Swiss canton of Valais can be ascribed to M. multiplex, whereas the haplotypes isolated from the geographic samples from Croatia, Slovenia, Carinthia, Styria, East Tyrol, and South Tyrol represent M. liechtensteini. The molecular data indicate that the distribution range of M. liechtensteini extends further to the north (Upper Styria) than has been assumed earlier. The haplotypes of M. bavaricus, together with the populations from North Tyrol, form a cluster clearly separated from M. liechtensteini. This result suggests that the North Tyrolean samples belong to M. bavaricus, a species thought to be extinct. Microtus tatricus splits off at the basis of the multiplex complex. Our sequence data do not support a close relationship between M. bavaricus and M. tatricus. The phylogenetic relationships deduced from the sequence data favour a hypothesis assuming three glacial refugia, in which M. multiplex, M. liechtensteini and M. bavaricus, respectively, survived the last one or two Alpine glaciations. [source] SEASONAL OCCURRENCE OF SPERM WHALE (PHYSETER MACROCEPHALUS) SOUNDS IN THE GULF OF ALASKA, 1999,2001MARINE MAMMAL SCIENCE, Issue 1 2004David K. Mellinger Abstract An acoustic survey for sperm whales was conducted in the Gulf of Alaska. Six autonomous hydrophones continuously recorded sound signals below 500 Hz from October 1999 to May 2001. After recovery, recordings were processed using an automatic process to detect usual clicks of sperm whales. The detection algorithm equalized background noise, summed the data in a frequency band, and then used autocorrelation to detect the whales' highly regular clicks. Detections were checked manually, revealing that 98% of detections did contain clicks. Results indicate that sperm whales are present in the Gulf of Alaska year-round; this result extends what is known from whaling data, which were gathered principally in summer. Sperm whales were more common in summer than winter by a factor of roughly two, and occurred less often at the westernmost site surveyed (52°N, 157°W) than elsewhere in the Gulf. This is the first study of sperm whales based exclusively on remote acoustic sensing. This methodology is feasible because sperm whale clicks extend to frequencies (,100 Hz) low enough to be recorded by low-sample-rate instruments that operate continuously, and because the detection algorithm has a low false-detection rate. The methodology may be replicated to facilitate comparisons between different time periods and geographic regions. [source] Genome-wide single nucleotide polymorphisms reveal population history and adaptive divergence in wild guppiesMOLECULAR ECOLOGY, Issue 5 2010EVA-MARIA WILLING Abstract Adaptation of guppies (Poecilia reticulata) to contrasting upland and lowland habitats has been extensively studied with respect to behaviour, morphology and life history traits. Yet population history has not been studied at the whole-genome level. Although single nucleotide polymorphisms (SNPs) are the most abundant form of variation in many genomes and consequently very informative for a genome-wide picture of standing natural variation in populations, genome-wide SNP data are rarely available for wild vertebrates. Here we use genetically mapped SNP markers to comprehensively survey genetic variation within and among naturally occurring guppy populations from a wide geographic range in Trinidad and Venezuela. Results from three different clustering methods, Neighbor-net, principal component analysis (PCA) and Bayesian analysis show that the population substructure agrees with geographic separation and largely with previously hypothesized patterns of historical colonization. Within major drainages (Caroni, Oropouche and Northern), populations are genetically similar, but those in different geographic regions are highly divergent from one another, with some indications of ancient shared polymorphisms. Clear genomic signatures of a previous introduction experiment were seen, and we detected additional potential admixture events. Headwater populations were significantly less heterozygous than downstream populations. Pairwise FST values revealed marked differences in allele frequencies among populations from different regions, and also among populations within the same region. FST outlier methods indicated some regions of the genome as being under directional selection. Overall, this study demonstrates the power of a genome-wide SNP data set to inform for studies on natural variation, adaptation and evolution of wild populations [source] The conceptualization and operationalization of race and ethnicity by health services researchersNURSING INQUIRY, Issue 2 2008Susan Moscou Racial and ethnic variables are routinely used in health services research. However, there is a growing debate within nursing and other disciplines about the usefulness of these variables in research. A qualitative study was undertaken (July 2004 , November 2004) to ascertain how researchers conceptualize and operationalize racial and ethnic data. Data were derived from interviews with 33 participants in academic health centers in differing geographic regions. Content analyses extracted manifest and latent meanings to construct categories depicting respondents' understandings of race and ethnicity in research. Race and ethnicity held several meanings but the subtext was often not clear because these terms were not operationalized. Measuring race and ethnicity quantitatively necessitated uniform classifications thus it was often necessary to impose a single racialized identity. Respondents recognized the problems with racial and ethnic variables but the majority still believed these variables were necessary and useful. Several researchers understood that racial and ethnic variables were used in ways that may stigmatize the populations studied. These respondents collected data on variables other than race and ethnicity to ascertain the causes of health differentials. The policy recommendation calls for a shift in thinking about how to use racial and ethnic variables in research. [source] Metapopulation dynamics across gradients , the relation between colonization and extinction in shaping the range edgeOIKOS, Issue 10 2009Beáta Oborny We study the dynamics of a metapopulation in which the rates of colonization and/or extinction change along an environmental gradient. Spatially explicit simulations are applied to compare two cases: in parent-dependent colonization (PDC) the rate of colonization is limited by the production of new individuals; in offspring-dependent colonization (ODC) it is limited by the success of establishment of the offspring. Thus, PDC depends on the quality of the parent's site, while ODC is dependent on the offspring's site. We combine PDC and ODC in a spatially implicit model. We study the steady-state distribution of a metapopulation, and ask whether the local densities of occupied sites at each position x along the gradient could be predicted from the local rates of colonization c(x) and extinction e(x). This prediction is not trivial, since the sites are connected, enabling a flow of individuals from more favorable to less favorable sites. The results show that at ODC a single parameter, c(x)/e(x), is sufficient for the prediction. Therefore, different species and geographic regions can be directly compared by appropriate rescaling: choosing the local average lifetime of occupancy, 1/e(x), for a time unit at each point along the gradient. This permits generalizations about the shape of range edges, and can help to predict the position of the boundary of a species' distribution. At PDC, rescaling is not possible: the whole profile of c(x) and e(x) along the gradient has to be taken into consideration. Nevertheless, rescaling gives a good approximation when the parent-dependent component of colonization does not change abruptly across space. [source] Martin Stutzmann: Editor, Teacher, Scientist and FriendPHYSICA STATUS SOLIDI (C) - CURRENT TOPICS IN SOLID STATE PHYSICS, Issue 2 2005Manuel Cardona On 2 January 1995 Martin Stutzmann became Editor-in-Chief of physica status solidi, replacing Professor E. Gutsche, who had led the journal through the stormy period involving the fall of the Iron Curtain, the unification of Germany and the change in its Eastern part, where physica status solidi was based, from "socialism as found in the real world" (a German concept) to real world capitalism. In 1995 it was thought that the process had been completed (we should have known better!) and after the retirement of Prof. Gutsche the new owners of physica status solidi (Wiley-VCH) decided that a change in scientific management was desirable to adapt to the new socio-political facts and to insure the scientific continuity of the journal. Martin had moved in 1993 from my department at the Max-Planck-Institute to Munich where he soon displayed a tremendous amount of science man- agement ability during the build-up of the Walter Schottky Institute. The search for a successor as Edi- tor-in-Chief was not easy: the job was not very glamorous after the upheavals which had taken place in the editorial world following the political changes. Somebody in the Editorial Boards must have suggested Martin Stutzmann. I am sure that there was opposition: one usually looks for a well-established person ready to leave his direct involvement in science and take up a new endeavor of a more administrative nature. Nevertheless, the powers that be soon realized that Martin was an excellent, if somewhat unconventional candidate who had enough energy to remain a topnotch scientist and to lead the journal in the difficult times ahead: he was offered the job. In the negotiations that followed, he insisted in getting the administrative structures that would allow him to improve the battered quality of the journal and to continue his scientific productivity. Today we are happy to see that he succeeded in both endeavors. The journal has since grown in size and considerably improved its quality. Martin Stutzmann's scientific output has continued and today he can be found listed among the 400 most cited physicists worldwide. According to the Institute of Scientific Information (ISI) he has published nearly 400 articles in source journals; they have been cited over 4600 times. His scientific visibility has been partly responsible for the success of the journal under his leadership. When he took over in 1995 the Impact Factors of physica status solidi (a) and (b) were about 0.5. Now they oscillate around 1.0. The journals occupy places 30 (a) and 29 (b) among the 57 condensed matter publications listed in the ISI. Six years ago these places were 34 (a) and 30 (b). The journal is even better placed with respect to the so-called cited half-life which is 8.2 years for pss (a) (place 16 among 57) and 6.7 years for pss (b) (place 20 among 57). Martin, of course, has contributed with his original publications to the success of the journal, having published 36 articles in pss(a) and 32 in pss(b). I would like to some of the editorial decisions implemented under Martin's leadership. They have been largely responsible for the quantitative improvements just described. Martin introduced international standards of peer review, usually involving two anonymous referees: The increase of the rejection rate from ca. 20% to 60% followed. He discontinued the Short Notes, which had become nearly irrelevant, and replaced them, in 1997 by Rapid Research Notes (today Rapid Research Letters) with especially strict reviewing rules and a rather attractive layout. Martin's participation in many international conferences and their organization gave him a handle to acquire the publication of conference proceedings. Organizing committees usually prefer publication in international journals rather than special books because of their guaranteed future availability in libraries and the partaking in the reviewing procedure. The journal became increasingly popular along these lines, a fact which moved Martin to launch in 2002 part (c) of the journal, devoted mainly, but not exclusively, to conference articles. Martin also introduced the publication of Feature Articles, topical issues, and the instrument of the Editor's Choice to highlight articles deemed to be especially interesting. He appointed Regional Editors (6 at this point) which represent the journal in important geographic regions. He also brought the journal online, a must these days. The upheavals that followed the collapse of most of the communist world, the rapid development of science in many emerging nations and the enhanced competitiveness, even in the developed countries, have not ebbed out. Some of them are particular damaging to the reputation of science in a world increasingly skeptical of its values. I am thinking of scientific misconduct and outright fraud, in the form of plagiarism and data fabrication. physica status solidi was also afflicted by this plague: after all, it happened in the best of families. Two of the most notorious offenders of the past decade, J. H. Schön and Y. Park, also visited physica status solidi. In two courageous editorials Martin Stutzmann and Stefan Hildebrandt (Managing Editor of the journal) rapidly exposed these cases of misconduct together with other cases in which there was also good reason to suspect misconduct. Some of the articles involved were rapidly retracted by the authors, others were not. It is reassuring to say that none of them had any impact worth mentioning (1,3 citations, mostly by the authors themselves or in the editorials just mentioned). Only few journal editors dared to convey to the readers a warning that some work of those authors may be faulty even if no air-tight proof was available. However, Martin and Stefan did. We wish that Martin will remain at the helm at least another decade, before he switches to research on the liquid state as practiced in Southern France. [source] Geographical differences in physiques of male youth of age 18,20 years in ChinaAMERICAN JOURNAL OF HUMAN BIOLOGY, Issue 1 2006Shang Lei Three national surveys on the physical status of 18-, 19-, and 20-year-old male candidates for military service were carried out in six geographic regions of China in 1955, 1974, and 2001. Data from these surveys for 72,000 individuals were compared by region, by time, and by age, and estimates of incremental changes by decade were made. Overall, at all time points, males in the north and northeast areas were larger and heavier than males in the southwest. Similarly, the proportion of males in the north and northeast who were overweight was greater than in the other areas. The proportion classified as "thin" was highest in the south, southwest, and northwest, reaching 42.6% in the northwest. When urban and rural areas were compared, the mean value of every measure in every region was higher for urban youth, with all but two comparisons reaching significance (P<0.05). Differences of chest circumference among age groups were significant, as were differences in height, weight, and body mass index for 18-year-olds compared to 20-year-olds. Overall, height increments per decade were greatest for males in the southwest (average of age groups 1.79 cm, 1974 to 2001) and least in the northeast (1.08), indicating some tendency toward convergence over time. Weight increments per decade over the same time were greatest in north China (1.37 kg) and least in the northwest region (0.58 kg). Am. J. Hum. Biol. 18:141,148, 2006. © 2005 Wiley-Liss, Inc. [source] Association analysis of fibre traits in Gossypium arboreum accessionsPLANT BREEDING, Issue 2 2008S. K. Kantartzi Abstract Advances in the use of diploid Asiatic species in cotton breeding require an understanding of the relatedness and ancestry of diploid cotton accessions, and identification of simple sequence repeat (SSR) markers associated with agronomically important phenotypic traits, for example, fibre quality. Fifty-six Gossypium arboreum germplasm accessions introduced from nine regions of Africa, Asia and Europe were evaluated for eight fibre characters (lint percentage, lint colour, elongation, micronaire, strength, 50% span length, 2.5% span length and maturity%) and genotyped with 98 SSR markers. When viewed across all accessions most of the SSR markers were polymorphic. Population structure analysis identified six main clusters for the accessions which corresponded to different geographic regions, indicating agreement between genetic and predefined populations. The general linear model method was used to disclose marker,trait associations. Marker,trait associations were investigated by fitting single marker regression models for phenotypic traits on marker band intensities with correction for population structure. This paper illustrates the potential of association mapping in diploid cotton, because existing phenotypic data, a modest number of SSR markers, and a pioneering statistical analysis, identified interesting associations. [source] Occurrence and survival of potato scab pathogens (Streptomyces species) on tuber lesions: quick diagnosis based on a PCR-based assayPLANT PATHOLOGY, Issue 3 2004M. J. Lehtonen A time-saving and cost-effective polymerase chain reaction (PCR)-based method was developed for species-specific detection of the scab pathogens (Streptomyces scabies and S. turgidiscabies) prevalent in potato (Solanum tuberosum) in northern Scandinavia. Species specificity of primers was verified using a collection of previously characterized Streptomyces strains isolated from potato scab lesions in Finland and Sweden. A total of 1245 scab lesions was tested from potato cvs Matilda and Sabina grown in the field in two geographic regions of Finland in 2000 and 2001. Freshly harvested or stored potato tubers were incubated at room temperature (18,21°C) under humid conditions for a few days. Bacterial growth was collected from scab lesions for DNA isolation and PCR. The two scab pathogens were detected in the same potato fields, tubers and scab lesions. The relative incidence of S. scabies was high in freshly harvested tubers but was much lower than that of S. turgidiscabies following storage. Both pathogens were seed-transmitted in Matilda and Sabina after 24 weeks of storage at 4°C. [source] | |||||||||||||||||||||||||||||||