Home About us Contact
|
Home About us Contact | ||
|
|
||
Different Geographic Regions (different + geographic_regions)
Selected AbstractsRapid Analysis of Glucose, Fructose, Sucrose, and Maltose in Honeys from Different Geographic Regions using Fourier Transform Infrared Spectroscopy and Multivariate AnalysisJOURNAL OF FOOD SCIENCE, Issue 2 2010Jun Wang ABSTRACT:, Quantitative analysis of glucose, fructose, sucrose, and maltose in different geographic origin honey samples in the world using the Fourier transform infrared (FTIR) spectroscopy and chemometrics such as partial least squares (PLS) and principal component regression was studied. The calibration series consisted of 45 standard mixtures, which were made up of glucose, fructose, sucrose, and maltose. There were distinct peak variations of all sugar mixtures in the spectral "fingerprint" region between 1500 and 800 cm,1. The calibration model was successfully validated using 7 synthetic blend sets of sugars. The PLS 2nd-derivative model showed the highest degree of prediction accuracy with a highest,R2 value of 0.999. Along with the canonical variate analysis, the calibration model further validated by high-performance liquid chromatography measurements for commercial honey samples demonstrates that FTIR can qualitatively and quantitatively determine the presence of glucose, fructose, sucrose, and maltose in multiple regional honey samples. [source] Prevalence of glucose-6-phosphate dehydrogenase deficiency in Northern GreeceINTERNAL MEDICINE JOURNAL, Issue 3 2008G. Ntaios Abstract Glucose-6-phosphate dehydrogenase (G6PD) deficiency affects more than 400 million persons worldwide. Its distribution varies significantly among different geographic regions and different population groups. Purpose of our study was to estimate its prevalence in Northern Greece. The dataset comprised 5161 newborns and adults who were screened for G6PD deficiency between July 2001 and March 2007. G6PD deficiency was detected by the dye reduction method. In the screened group, 6.3% of subjects were G6PD deficient. Moderate enzyme deficiency was shown in 139 individuals (2.7%). Complete deficiency was identified in 3.7%. The prevalence of G6PD deficiency in Northern Greece is much higher compared with the general Greek population. Moreover, G6PD prevalence in the male sex is much higher , almost double , that in the female sex. [source] Absence of Borrelia burgdorferi DNA in cutaneous B-cell lymphomas from the United StatesJOURNAL OF CUTANEOUS PATHOLOGY, Issue 10 2001Gary S. Wood Background: An association between Borrelia burgdorferi and cutaneous B-cell lymphoma (CBCL) has been made in several European countries. The evidence in favor of such an association has recently been based on more definitive tests for the pathogenetic role of B. burgdorferi in CBCL, including positive cultures or polymerase chain reaction (PCR) amplification of borrelial DNA from lesional skin. However, there is only one report of B. burgdorferi in four North American cases of B-cell lymphoma. Methods: We retrieved 38 cases of primary and secondary CBCL from different geographic regions of the United States. Two separate techniques were used to detect borrelial DNA by PCR, a nested PCR method to amplify a B. burgdorferi -specific gene as well as a borrelial chromosomal Ly-1 clone amplification method. Southern blot hybridization was used for confirmation of the PCR results. Results: No B. burgdorferi -specific DNA was detected in any of the 38 CBCL cases, whereas detectable PCR products were obtained with our positive controls. Conclusions: Our findings, in light of previous studies, suggest that B. burgdorferi plays a minimal role in the development or pathogenesis of CBCL in the United States. The findings also suggest that the geographic variations in the clinical manifestations of B. burgdorferi are indeed real and may be secondary to the genetic and phenotypic differences between B. burgdorferi strains present in Europe and North America. [source] URP-based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of WheatJOURNAL OF PHYTOPATHOLOGY, Issue 4 2010Rashmi Aggarwal Abstract Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs') are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5,GTGTGCGATCAGTTGCTGGG3,) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. [source] Use of RAPD and ISSR Markers in Detection of Genetic Variation and Population Structure among Fusarium oxysporum f. sp. ciceris Isolates on Chickpea in TurkeyJOURNAL OF PHYTOPATHOLOGY, Issue 3 2008H. Bayraktar Abstract Genetic variation among the isolates of Fusarium oxysporum f. sp. ciceris, the causal agent of chickpea wilt worldwide, was analysed using pathogenicity tests and molecular markers , random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) polymorphism. Hundred and eight isolates were obtained from diseased chickpea plants in 13 different provinces of Turkey, out of which 74 isolates were assessed using 30 arbitrary decamer primers and 20 ISSR primers. Unweighted pair-grouped method by arithmetic average cluster analysis of RAPD, ISSR and RAPD + ISSR datasets provided a substantially similar discrimination among Turkish isolates and divided into three major groups. Group 1, 2 and 3 consisted of 41, 18 and 15 isolates, respectively. These methods revealed a considerable genetic variation among Turkish isolates, but no correlation with regard to the clustering of isolates from different geographic regions. Analysis of molecular variance confirmed that most genetic variability resulted from the differences among isolates within regions. Our results also indicated that the low-genetic differentiation (FST) and high gene flow (Nm) among populations had a significant effect on the emergence and evolutionary development of F. oxysporum f. sp. ciceris. This is the first report on genetic diversity and population structure of F. oxysporum isolates on chickpea in Turkey. [source] Genome-wide single nucleotide polymorphisms reveal population history and adaptive divergence in wild guppiesMOLECULAR ECOLOGY, Issue 5 2010EVA-MARIA WILLING Abstract Adaptation of guppies (Poecilia reticulata) to contrasting upland and lowland habitats has been extensively studied with respect to behaviour, morphology and life history traits. Yet population history has not been studied at the whole-genome level. Although single nucleotide polymorphisms (SNPs) are the most abundant form of variation in many genomes and consequently very informative for a genome-wide picture of standing natural variation in populations, genome-wide SNP data are rarely available for wild vertebrates. Here we use genetically mapped SNP markers to comprehensively survey genetic variation within and among naturally occurring guppy populations from a wide geographic range in Trinidad and Venezuela. Results from three different clustering methods, Neighbor-net, principal component analysis (PCA) and Bayesian analysis show that the population substructure agrees with geographic separation and largely with previously hypothesized patterns of historical colonization. Within major drainages (Caroni, Oropouche and Northern), populations are genetically similar, but those in different geographic regions are highly divergent from one another, with some indications of ancient shared polymorphisms. Clear genomic signatures of a previous introduction experiment were seen, and we detected additional potential admixture events. Headwater populations were significantly less heterozygous than downstream populations. Pairwise FST values revealed marked differences in allele frequencies among populations from different regions, and also among populations within the same region. FST outlier methods indicated some regions of the genome as being under directional selection. Overall, this study demonstrates the power of a genome-wide SNP data set to inform for studies on natural variation, adaptation and evolution of wild populations [source] Association analysis of fibre traits in Gossypium arboreum accessionsPLANT BREEDING, Issue 2 2008S. K. Kantartzi Abstract Advances in the use of diploid Asiatic species in cotton breeding require an understanding of the relatedness and ancestry of diploid cotton accessions, and identification of simple sequence repeat (SSR) markers associated with agronomically important phenotypic traits, for example, fibre quality. Fifty-six Gossypium arboreum germplasm accessions introduced from nine regions of Africa, Asia and Europe were evaluated for eight fibre characters (lint percentage, lint colour, elongation, micronaire, strength, 50% span length, 2.5% span length and maturity%) and genotyped with 98 SSR markers. When viewed across all accessions most of the SSR markers were polymorphic. Population structure analysis identified six main clusters for the accessions which corresponded to different geographic regions, indicating agreement between genetic and predefined populations. The general linear model method was used to disclose marker,trait associations. Marker,trait associations were investigated by fitting single marker regression models for phenotypic traits on marker band intensities with correction for population structure. This paper illustrates the potential of association mapping in diploid cotton, because existing phenotypic data, a modest number of SSR markers, and a pioneering statistical analysis, identified interesting associations. [source] Sound production in four damselfish (Dascyllus) species: phyletic relationships?BIOLOGICAL JOURNAL OF THE LINNEAN SOCIETY, Issue 4 2009ERIC PARMENTIER Most studies of fish sounds show that the sounds are species-specific, with unique spectral and timing characteristics. This raises the question as to whether these sounds can be used to understand phyletic relationships between species and which acoustic parameters are subject to variation between species. In the present study, 597 sounds (and 2540 pulses) related to signal jumps of four Dascyllus species (Dascyllus aruanus, Dascyllus trimaculatus, Dascyllus albisella, and Dascyllus flavicaudus) from different geographic regions (Madagascar, Moorea, Rangiroa, and Hawaii) were analysed. It was possible to discern species-specific sounds, but also variation in sounds between populations. Large variations in sound length were found between Dascyllus species, whereas differences in interpulse duration were found to be variable between populations. In the regions where species live in sympatry, it appears that they restrict the variability in their sounds. This could comprise evidence of adaptation with character displacement of sonic characteristics where different species co-occur. However, sonic characteristics still overlapped substantially between species, suggesting that females would need to sample more than one sound and potentially use other cues to discriminate between species. © 2009 The Linnean Society of London, Biological Journal of the Linnean Society, 2009, 97, 928,940. [source] Support and intervention groups for adolescents with cancer in two Ontario communities,CANCER, Issue S7 2006Maru Barrera PhD Abstract Adolescents who are treated for cancer must learn to negotiate challenging developmental tasks in the context of their treatment and adverse effects. Adverse affects of disease and treatment may prevent some of these adolescents from achieving full psychosocial development. Two programs developed independently to address the psychosocial and unique contextual needs of adolescents and young adults from different geographic regions in Ontario, Central urban and Northeastern rural, are described. The program in the urban area consists of eight 2-h sessions that combined structured creative activities and informal discussions of issues generated by adolescents; it includes a pre- post- intervention evaluation with standardized questionnaires. The Northeastern rural program consists of a monthly support open group that encourages sharing personal experiences and an annual expressive art retreat; both components include informal evaluation. Formal evaluation of these programs is in progress. Informal feedback from participants and parents suggest positive effects. These distinct and unique programs continue to evolve, as they address the unique psychosocial needs of adolescents and young adults in urban and rural areas. Cancer 2006. © 2006 American Cancer Society. [source] | |||||||||||||